Rmu_sc0001581.1_g000005

Zinc finger protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001581.1
Physical Location & Seq
Forward (+)
13920 .. 14581
662 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001581.1_g000005.1.cds

Sequence Viewer

Length: 453 bp
atgcctgaaagccatattcagtcctgccaccaacatactacctgcgagatatgtgggaccaaacagctgaaaaagaatatcaaaagtcatcttcgcacacatgaagagggaggttcaatggagagaattaaatgtgattatgagggctgtcttcagacgtttactaaaaaatcgaatctccgtcaacatgtgaaggctgttcaccttgaaaataaaccatttgtctgttgctttccgggttgtggcaaaagatttgcctacaagcatgtgaaagacaaccatgaaaagaggggatgccacgtccatgcacacggggactttgaagaggctgatgaaaaattccggtccaggccaaggggagggcgtaagaggcagtgccccactgtagaaatgttggttcggaaaagggtgagtccttcaaaacaatcgaggcagggctctgagaacttctga

Protein Analysis

150

Amino Acids

17.39

Weight (kDa)

9.48

Isoelectric Point (pI)

72.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000543)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G72050 AT1G72050 AT1G72050 AT1G72050
fragaria_vesca FvH4_1g04960 FvH4_1g04960 FvH4_1g04960 FvH4_1g04960 FvH4_1g04960 FvH4_1g04960 FvH4_1g04960 FvH4_1g04960 FvH4_1g04960 FvH4_1g04960 FvH4_1g04960 FvH4_1g27520 FvH4_1g27520 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190 FvH4_4g26190
malus_domestica MD02G1048300.v1.1 MD15G1186600.v1.1 MD15G1411000.v1.1
prunus_persica Prupe.1G551600_v2.0.a1 Prupe.1G551600_v2.0.a1 Prupe.1G551600_v2.0.a1 Prupe.1G551600_v2.0.a1 Prupe.7G229900_v2.0.a1 Prupe.7G229900_v2.0.a1
pyrus_communis pycom02g04050 pycom15g36580
rosa_chinensis RchiOBHm_Chr2g0090581 RchiOBHm_Chr2g0090591 RchiOBHm_Chr2g0120581 RchiOBHm_Chr5g0055971 RchiOBHm_Chr7g0228681 RchiOBHm_Chr7g0228721 RchiOBHm_Chr7g0228771
rosa_laevigata RLG00000001547 RLG00000016122 RLG00000035039
rosa_multiflora Rmu_co8222532.1_g000001 Rmu_co8474195.1_g000001 Rmu_sc0001581.1_g000005 Rmu_sc0004514.1_g000033 Rmu_sc0015624.1_g000002
rosa_roxburghii Rroxscaffold_1G00024300 Rroxscaffold_2G00151010 Rroxscaffold_3G00230860 Rroxscaffold_3G00230910
rosa_rugosa Rorug02G0009300 Rorug02G0009300 Rorug05G0296700 Rorug07G0251500 Rorug07G0251600 Rorug07G0251700 Rorug07G0251800
rosa_samantha Rh2AG054400 Rh2BG053700 Rh2CG055900 Rh2DG054800 Rh5BG378200 Rh5CG401600 Rh7AG403700 Rh7AG404000 Rh7AG404600 Rh7AG405100 Rh7BG384300 Rh7CG422800 Rh7DG399300
rosa_wichuraiana Rw2G004740 Rw2G022930 Rw5G034520 Rw7G033550 Rw7G033570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 50
AcsI RAATTY 1 cut(s) 338
AcuI CTGAAG 1 cut(s) 137
AfiI CCNNNNNNNGG 3 cut(s) 242, 354, 359
AflIII ACRYGT 1 cut(s) 187
AgsI TTSAA 4 cut(s) 117, 209, 323, 420
AjiI CACGTC 1 cut(s) 301
AjnI CCWGG 1 cut(s) 347
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
AoxI GGCC 1 cut(s) 350
ApoI RAATTY 1 cut(s) 338
AspS9I GGNCC 2 cut(s) 57, 345
AsuC2I CCSGG 1 cut(s) 237
AsuHPI GGTGA 2 cut(s) 194, 421
AvaII GGWCC 2 cut(s) 57, 345
BaeGI GKGCMC 1 cut(s) 380
BanII GRGCYC 1 cut(s) 440
BbsI GAAGAC 1 cut(s) 143
BciT130I CCWGG 1 cut(s) 349
BcnI CCSGG 1 cut(s) 237
BfmI CTRYAG 1 cut(s) 384
BfuAI ACCTGC 1 cut(s) 50
Bme1390I CCNGG 2 cut(s) 237, 349
Bme18I GGWCC 2 cut(s) 57, 345
BmgBI CACGTC 1 cut(s) 301
BmgT120I GGNCC 2 cut(s) 57, 345
BmiI GGNNCC 1 cut(s) 58
BmrFI CCNGG 2 cut(s) 237, 349
BmsI GCATC 1 cut(s) 284
BpiI GAAGAC 1 cut(s) 143
BpuMI CCSGG 1 cut(s) 237
BsaJI CCNNGG 1 cut(s) 353
BsaWI WCCGGW 1 cut(s) 342
Bsc4I CCNNNNNNNGG 3 cut(s) 242, 354, 359
BseBI CCWGG 1 cut(s) 349
BseDI CCNNGG 1 cut(s) 353
BseGI GGATG 1 cut(s) 299
BseLI CCNNNNNNNGG 3 cut(s) 242, 354, 359
BseMII CTCAG 1 cut(s) 432
BseSI GKGCMC 1 cut(s) 380
BshFI GGCC 1 cut(s) 352
BsiSI CCGG 2 cut(s) 236, 343
BslFI GGGAC 2 cut(s) 70, 329
BslI CCNNNNNNNGG 3 cut(s) 242, 354, 359
BsmFI GGGAC 2 cut(s) 70, 329
BsnI GGCC 1 cut(s) 352
Bsp1286I GDGCHC 2 cut(s) 380, 440
BspANI GGCC 1 cut(s) 352
BspCNI CTCAG 1 cut(s) 433
BspLI GGNNCC 1 cut(s) 58
BspMI ACCTGC 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 353
BssT1I CCWWGG 1 cut(s) 353
Bst2UI CCWGG 1 cut(s) 349
Bst4CI ACNGT 1 cut(s) 385
Bst6I CTCTTC 2 cut(s) 99, 318
BstDEI CTNAG 1 cut(s) 441
BstF5I GGATG 1 cut(s) 299
BstMWI GCNNNNNNNGC 1 cut(s) 370
BstNI CCWGG 1 cut(s) 349
BstNSI RCATGY 2 cut(s) 191, 269
BstSCI CCNGG 2 cut(s) 235, 347
BstSFI CTRYAG 1 cut(s) 384
BstSLI GKGCMC 1 cut(s) 380
BstV2I GAAGAC 1 cut(s) 143
BsuRI GGCC 1 cut(s) 352
BtrI CACGTC 1 cut(s) 301
BtsCI GGATG 1 cut(s) 299
BtsI GCAGTG 1 cut(s) 380
BtsIMutI CAGTG 2 cut(s) 380, 381
BveI ACCTGC 1 cut(s) 50
Cfr13I GGNCC 2 cut(s) 57, 345
CviAII CATG 5 cut(s) 101, 188, 266, 281, 305
CviJI RGCY 7 cut(s) 12, 67, 147, 197, 329, 352, 438
CviKI_1 RGCY 7 cut(s) 12, 67, 147, 197, 329, 352, 438
DdeI CTNAG 1 cut(s) 441
Eam1104I CTCTTC 2 cut(s) 99, 318
EarI CTCTTC 2 cut(s) 99, 318
Eco130I CCWWGG 1 cut(s) 353
Eco24I GRGCYC 1 cut(s) 440
Eco47I GGWCC 2 cut(s) 57, 345
Eco57I CTGAAG 1 cut(s) 137
EcoRII CCWGG 1 cut(s) 347
EcoT14I CCWWGG 1 cut(s) 353
EcoT38I GRGCYC 1 cut(s) 440
ErhI CCWWGG 1 cut(s) 353
FaeI CATG 5 cut(s) 104, 191, 269, 284, 308
FaiI YATR 9 cut(s) 15, 36, 52, 102, 141, 189, 267, 282, 306
FaqI GGGAC 2 cut(s) 70, 329
FatI CATG 5 cut(s) 100, 187, 265, 280, 304
FokI GGATG 1 cut(s) 306
FriOI GRGCYC 1 cut(s) 440
HaeIII GGCC 1 cut(s) 352
HapII CCGG 2 cut(s) 236, 343
Hin1II CATG 5 cut(s) 104, 191, 269, 284, 308
HincII GTYRAC 1 cut(s) 185
HindII GTYRAC 1 cut(s) 185
HinfI GANTC 2 cut(s) 175, 412
HpaII CCGG 2 cut(s) 236, 343
HphI GGTGA 2 cut(s) 194, 421
Hpy166II GTNNAC 3 cut(s) 162, 185, 202
Hpy188I TCNGA 4 cut(s) 156, 402, 442, 452
Hpy8I GTNNAC 3 cut(s) 162, 185, 202
HpyAV CCTTC 2 cut(s) 187, 426
HpyCH4III ACNGT 1 cut(s) 385
HpyCH4IV ACGT 2 cut(s) 158, 300
HpyCH4V TGCA 1 cut(s) 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 370
HpyF3I CTNAG 1 cut(s) 441
HpySE526I ACGT 2 cut(s) 158, 300
Hsp92II CATG 5 cut(s) 104, 191, 269, 284, 308
LpnPI CCDG 8 cut(s) 18, 37, 55, 249, 334, 356, 361, 419
LweI GCATC 1 cut(s) 284
MaeII ACGT 2 cut(s) 158, 300
MboII GAAGA 4 cut(s) 83, 116, 143, 335
MhlI GDGCHC 2 cut(s) 380, 440
MluCI AATT 2 cut(s) 126, 338
MlyI GAGTC 1 cut(s) 421
MnlI CCTC 8 cut(s) 100, 104, 136, 282, 319, 353, 363, 423
MseI TTAA 1 cut(s) 129
MslI CAYNNNNRTG 1 cut(s) 303
MspA1I CMGCKG 1 cut(s) 67
MspI CCGG 2 cut(s) 236, 343
MspR9I CCNGG 2 cut(s) 237, 349
MvaI CCWGG 1 cut(s) 349
MwoI GCNNNNNNNGC 1 cut(s) 370
NciI CCSGG 1 cut(s) 237
NlaIII CATG 5 cut(s) 104, 191, 269, 284, 308
NlaIV GGNNCC 1 cut(s) 58
NspI RCATGY 2 cut(s) 191, 269
PciI ACATGT 1 cut(s) 187
PfeI GAWTC 1 cut(s) 175
PleI GAGTC 1 cut(s) 420
PpsI GAGTC 1 cut(s) 420
PscI ACATGT 1 cut(s) 187
Psp6I CCWGG 1 cut(s) 347
PspGI CCWGG 1 cut(s) 347
PspN4I GGNNCC 1 cut(s) 58
PspPI GGNCC 2 cut(s) 57, 345
PvuII CAGCTG 1 cut(s) 67
RseI CAYNNNNRTG 1 cut(s) 303
SaqAI TTAA 1 cut(s) 129
Sau96I GGNCC 2 cut(s) 57, 345
SchI GAGTC 1 cut(s) 421
ScrFI CCNGG 2 cut(s) 237, 349
SduI GDGCHC 2 cut(s) 380, 440
SetI ASST 6 cut(s) 44, 69, 115, 161, 207, 303
SfaNI GCATC 1 cut(s) 284
SfcI CTRYAG 1 cut(s) 384
SinI GGWCC 2 cut(s) 57, 345
SmiMI CAYNNNNRTG 1 cut(s) 303
Sse9I AATT 2 cut(s) 126, 338
StyD4I CCNGG 2 cut(s) 235, 347
StyI CCWWGG 1 cut(s) 353
TaaI ACNGT 1 cut(s) 385
TaiI ACGT 2 cut(s) 161, 303
TaqI TCGA 2 cut(s) 173, 428
TasI AATT 2 cut(s) 126, 338
TfiI GAWTC 1 cut(s) 175
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TscAI CASTG 2 cut(s) 380, 388
TspDTI ATGAA 3 cut(s) 117, 297, 348
TspGWI ACGGA 1 cut(s) 170
TspRI CASTG 2 cut(s) 380, 388
VpaK11BI GGWCC 2 cut(s) 57, 345
XapI RAATTY 1 cut(s) 338
XceI RCATGY 2 cut(s) 191, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.