Rmu_sc0004158.1_g000005

Vesicle-associated protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004158.1
Physical Location & Seq
Forward (+)
14349 .. 14800
452 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004158.1_g000005.1.cds

Sequence Viewer

Length: 273 bp
atgcaatgcaaggacaagtttctccttcagagtgtaaaaacgaatgatggtgcaactccaaaggagattactctagaagtgttcaatgaagaggcaggacatgtggttgaggagtgcaaattcagagtggtgtatgtttctccacctcagcccccttctccggtctcagaaaggtcggaggaagggtcttcaccaagagcttcaatagtggagaatgaaaatcttaatgctgctgagtttgccaatgctgcaaggactttcggagcagcttga

Protein Analysis

90

Amino Acids

9.8

Weight (kDa)

4.8

Isoelectric Point (pI)

67.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 119
AcuI CTGAAG 1 cut(s) 11
AfiI CCNNNNNNNGG 1 cut(s) 160
AflIII ACRYGT 1 cut(s) 100
AgsI TTSAA 2 cut(s) 85, 204
AluBI AGCT 2 cut(s) 200, 269
AluI AGCT 2 cut(s) 200, 269
Alw26I GTCTC 1 cut(s) 169
ApeKI GCWGC 3 cut(s) 230, 248, 266
ApoI RAATTY 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 183
BbsI GAAGAC 1 cut(s) 180
BbvCI CCTCAGC 1 cut(s) 147
BbvI GCAGC 2 cut(s) 217, 235
BccI CCATC 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 169
BfaI CTAG 1 cut(s) 74
BisI GCNGC 3 cut(s) 231, 249, 267
BlsI GCNGC 3 cut(s) 232, 250, 268
BpiI GAAGAC 1 cut(s) 180
Bpu10I CCTNAGC 1 cut(s) 147
BsaI GGTCTC 1 cut(s) 169
BsaWI WCCGGW 1 cut(s) 160
BsaXI ACNNNNNCTCC 2 cut(s) 170, 200
Bsc4I CCNNNNNNNGG 1 cut(s) 160
Bse3DI GCAATG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 160
BseMI GCAATG 1 cut(s) 11
BseMII CTCAG 3 cut(s) 161, 180, 225
BseRI GAGGAG 1 cut(s) 125
BseXI GCAGC 2 cut(s) 217, 235
BsiSI CCGG 1 cut(s) 161
BslI CCNNNNNNNGG 1 cut(s) 160
BsmAI GTCTC 1 cut(s) 169
Bso31I GGTCTC 1 cut(s) 169
BspCNI CTCAG 3 cut(s) 160, 179, 226
BspTNI GGTCTC 1 cut(s) 169
BsrDI GCAATG 1 cut(s) 11
Bst6I CTCTTC 1 cut(s) 84
BstDEI CTNAG 3 cut(s) 147, 166, 234
BstMAI GTCTC 1 cut(s) 169
BstMWI GCNNNNNNNGC 2 cut(s) 239, 248
BstNSI RCATGY 1 cut(s) 104
BstV1I GCAGC 2 cut(s) 217, 235
BstV2I GAAGAC 1 cut(s) 180
CviAII CATG 1 cut(s) 101
CviJI RGCY 3 cut(s) 151, 200, 269
CviKI_1 RGCY 3 cut(s) 151, 200, 269
DdeI CTNAG 3 cut(s) 147, 166, 234
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
Eco31I GGTCTC 1 cut(s) 169
Eco57I CTGAAG 1 cut(s) 11
FaeI CATG 1 cut(s) 104
FaiI YATR 2 cut(s) 102, 135
FatI CATG 1 cut(s) 100
Fnu4HI GCNGC 3 cut(s) 231, 249, 267
Fsp4HI GCNGC 3 cut(s) 231, 249, 267
FspBI CTAG 1 cut(s) 74
GluI GCNGC 3 cut(s) 231, 249, 267
HapII CCGG 1 cut(s) 161
Hin1II CATG 1 cut(s) 104
HpaII CCGG 1 cut(s) 161
HphI GGTGA 1 cut(s) 183
Hpy188I TCNGA 5 cut(s) 30, 125, 169, 178, 263
Hpy188III TCNNGA 1 cut(s) 74
HpyAV CCTTC 3 cut(s) 35, 165, 176
HpyCH4V TGCA 5 cut(s) 4, 9, 53, 117, 251
HpyF10VI GCNNNNNNNGC 2 cut(s) 239, 248
HpyF3I CTNAG 3 cut(s) 147, 166, 234
Hsp92II CATG 1 cut(s) 104
LmnI GCTCC 1 cut(s) 263
LpnPI CCDG 2 cut(s) 81, 174
Lsp1109I GCAGC 2 cut(s) 217, 235
MaeI CTAG 1 cut(s) 74
MboII GAAGA 2 cut(s) 101, 180
MluCI AATT 1 cut(s) 119
MmeI TCCRAC 1 cut(s) 156
MnlI CCTC 4 cut(s) 85, 103, 156, 172
MseI TTAA 1 cut(s) 225
MspI CCGG 1 cut(s) 161
MwoI GCNNNNNNNGC 2 cut(s) 239, 248
NlaIII CATG 1 cut(s) 104
NspI RCATGY 1 cut(s) 104
PciI ACATGT 1 cut(s) 100
PkrI GCNGC 3 cut(s) 232, 250, 268
PscI ACATGT 1 cut(s) 100
SaqAI TTAA 1 cut(s) 225
SatI GCNGC 3 cut(s) 231, 249, 267
SetI ASST 4 cut(s) 148, 176, 202, 271
SgeI CNNG 8 cut(s) 22, 28, 86, 108, 113, 173, 207, 264
Sse9I AATT 1 cut(s) 119
SspMI CTAG 1 cut(s) 74
TasI AATT 1 cut(s) 119
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TseI GCWGC 3 cut(s) 230, 248, 266
TspDTI ATGAA 2 cut(s) 102, 231
XapI RAATTY 1 cut(s) 119
XbaI TCTAGA 1 cut(s) 73
XceI RCATGY 1 cut(s) 104
XspI CTAG 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.