Rroxscaffold_2G00106200

Vesicle-associated protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
29784142 .. 29790411
6270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00106200.1

Sequence Viewer

Length: 420 bp
ATGAAAGCATATGTATCTAAAGACAGCTTGGCAAGTCCAAGTCCGCAACATGAACAAATTTCCGTGCAAGCACAAAAAGAGGTTGCTTCAGACATGCAATGCAAGGACAAGTTTCTCCTTCAGCGTGTAAAAACCAATGATGGTGCAACTATAAAGAAAATTACTCTAGAAGTGGCTGCAAAAGGATTTTCGGAGCAGCTTGAAGCTCTGGAGAGATCTGCAGAGCAAAACCCATACACCTTGATGAAGAATACCAAACACCCAATAGATTCCCCGACGCTGTCAATAAGTCAATTACTGGATTGGAGAAAGAGACGCTTAAACAACTGCAAGTCTCTTAGATCTTCAACCGATAGCCCATATATCCAATCCTATATCCAAAAGCAAATGAAGTGTCTTCAACACCATATGAACCAATAA

Protein Analysis

139

Amino Acids

15.91

Weight (kDa)

9.4

Isoelectric Point (pI)

55.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 44
AcsI RAATTY 1 cut(s) 57
AcuI CTGAAG 2 cut(s) 72, 104
AgsI TTSAA 3 cut(s) 203, 348, 401
AluBI AGCT 3 cut(s) 27, 199, 206
AluI AGCT 3 cut(s) 27, 199, 206
Alw26I GTCTC 2 cut(s) 307, 339
ApeKI GCWGC 2 cut(s) 176, 196
ApoI RAATTY 1 cut(s) 57
ArsI GACNNNNNNTTYG 2 cut(s) 379, 411
BbsI GAAGAC 1 cut(s) 389
BbvI GCAGC 2 cut(s) 163, 208
BccI CCATC 1 cut(s) 134
BcoDI GTCTC 2 cut(s) 307, 339
BfaI CTAG 1 cut(s) 167
BfmI CTRYAG 1 cut(s) 219
BglII AGATCT 2 cut(s) 215, 341
BisI GCNGC 2 cut(s) 177, 197
BlsI GCNGC 2 cut(s) 178, 198
BpiI GAAGAC 1 cut(s) 389
BpmI CTGGAG 1 cut(s) 230
Bse1I ACTGG 1 cut(s) 303
Bse3DI GCAATG 1 cut(s) 104
BseMI GCAATG 1 cut(s) 104
BseNI ACTGG 1 cut(s) 303
BseXI GCAGC 2 cut(s) 163, 208
BsmAI GTCTC 2 cut(s) 307, 339
BsmBI CGTCTC 1 cut(s) 307
Bsp143I GATC 2 cut(s) 215, 341
BspACI CCGC 1 cut(s) 44
BspMAI CTGCAG 1 cut(s) 223
BsrDI GCAATG 1 cut(s) 104
BsrI ACTGG 1 cut(s) 303
BssMI GATC 2 cut(s) 215, 341
BstC8I GCNNGC 1 cut(s) 69
BstDEI CTNAG 1 cut(s) 338
BstKTI GATC 2 cut(s) 218, 344
BstMAI GTCTC 2 cut(s) 307, 339
BstMBI GATC 2 cut(s) 215, 341
BstNSI RCATGY 1 cut(s) 97
BstSFI CTRYAG 1 cut(s) 219
BstV1I GCAGC 2 cut(s) 163, 208
BstV2I GAAGAC 1 cut(s) 389
BstX2I RGATCY 2 cut(s) 215, 341
BstYI RGATCY 2 cut(s) 215, 341
Cac8I GCNNGC 1 cut(s) 69
CseI GACGC 2 cut(s) 286, 324
CviAII CATG 2 cut(s) 50, 94
CviJI RGCY 5 cut(s) 27, 176, 199, 206, 357
CviKI_1 RGCY 5 cut(s) 27, 176, 199, 206, 357
DdeI CTNAG 1 cut(s) 338
DpnI GATC 2 cut(s) 217, 343
DpnII GATC 2 cut(s) 215, 341
Eco57I CTGAAG 2 cut(s) 72, 104
Esp3I CGTCTC 1 cut(s) 307
FaeI CATG 2 cut(s) 53, 97
FalI AAGNNNNNCTT 2 cut(s) 302, 334
FatI CATG 2 cut(s) 49, 93
FauNDI CATATG 2 cut(s) 10, 408
Fnu4HI GCNGC 2 cut(s) 177, 197
Fsp4HI GCNGC 2 cut(s) 177, 197
FspBI CTAG 1 cut(s) 167
GluI GCNGC 2 cut(s) 177, 197
GsuI CTGGAG 1 cut(s) 230
HgaI GACGC 2 cut(s) 286, 324
Hin1II CATG 2 cut(s) 53, 97
HinfI GANTC 1 cut(s) 269
Hpy188I TCNGA 2 cut(s) 91, 193
Hpy188III TCNNGA 2 cut(s) 167, 209
Hpy99I CGWCG 1 cut(s) 280
HpyAV CCTTC 1 cut(s) 128
HpyCH4V TGCA 7 cut(s) 67, 97, 102, 146, 179, 221, 330
HpyF3I CTNAG 1 cut(s) 338
Hsp92II CATG 2 cut(s) 53, 97
Kzo9I GATC 2 cut(s) 215, 341
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 2 cut(s) 194, 284
Lsp1109I GCAGC 2 cut(s) 163, 208
MaeI CTAG 1 cut(s) 167
MalI GATC 2 cut(s) 217, 343
MboI GATC 2 cut(s) 215, 341
MboII GAAGA 3 cut(s) 259, 336, 389
MflI RGATCY 2 cut(s) 215, 341
MluCI AATT 3 cut(s) 57, 159, 293
MnlI CCTC 1 cut(s) 73
MseI TTAA 1 cut(s) 320
MslI CAYNNNNRTG 1 cut(s) 242
NdeI CATATG 2 cut(s) 10, 408
NdeII GATC 2 cut(s) 215, 341
NlaIII CATG 2 cut(s) 53, 97
NspI RCATGY 1 cut(s) 97
PfeI GAWTC 1 cut(s) 269
PflFI GACNNNGTC 1 cut(s) 280
PkrI GCNGC 2 cut(s) 178, 198
PstI CTGCAG 1 cut(s) 223
PsuI RGATCY 2 cut(s) 215, 341
PsyI GACNNNGTC 1 cut(s) 280
RseI CAYNNNNRTG 1 cut(s) 242
SaqAI TTAA 1 cut(s) 320
SatI GCNGC 2 cut(s) 177, 197
Sau3AI GATC 2 cut(s) 215, 341
SetI ASST 5 cut(s) 29, 84, 201, 208, 242
SfcI CTRYAG 1 cut(s) 219
SmiMI CAYNNNNRTG 1 cut(s) 242
Sse9I AATT 3 cut(s) 57, 159, 293
SsiI CCGC 1 cut(s) 44
SspMI CTAG 1 cut(s) 167
TasI AATT 3 cut(s) 57, 159, 293
TfiI GAWTC 1 cut(s) 269
Tru1I TTAA 1 cut(s) 320
Tru9I TTAA 1 cut(s) 320
TseI GCWGC 2 cut(s) 176, 196
TspDTI ATGAA 4 cut(s) 17, 66, 260, 404
TspGWI ACGGA 1 cut(s) 52
Tth111I GACNNNGTC 1 cut(s) 280
XapI RAATTY 1 cut(s) 57
XbaI TCTAGA 1 cut(s) 166
XceI RCATGY 1 cut(s) 97
XspI CTAG 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.