Rh2BG172200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0001420
Physical Location & Seq
Forward (+)
15149911 .. 15152176
2266 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG172200.1

Sequence Viewer

Length: 219 bp
ATGAATTCTGTGCTAGAAGGGACTATGTTACATTTGAAAGTTAAAGAAAGAGGCTGCTCCAGACATGCAATGCAAGGACAAGTTTCTCATTTAGAGTATAAAAATGACGGTACGACTCCAAAGGAGATTACTCCAGAAGTGGTAATTACATTACACAATGTTGTGAATTCTGATATGTGTGGGTTCTTTATGTCGAATGCCATTCATTTGGGGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.0

Weight (kDa)

6.16

Isoelectric Point (pI)

23.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 4, 166
AfaI GTAC 1 cut(s) 112
AgsI TTSAA 1 cut(s) 37
ApeKI GCWGC 1 cut(s) 54
ApoI RAATTY 2 cut(s) 4, 166
BbvI GCAGC 1 cut(s) 41
BfaI CTAG 1 cut(s) 14
BisI GCNGC 1 cut(s) 55
BlsI GCNGC 1 cut(s) 56
BpmI CTGGAG 2 cut(s) 43, 117
Bse3DI GCAATG 1 cut(s) 75
BseMI GCAATG 1 cut(s) 75
BseXI GCAGC 1 cut(s) 41
BslFI GGGAC 1 cut(s) 34
BsmFI GGGAC 1 cut(s) 34
BsmI GAATGC 1 cut(s) 202
BsrDI GCAATG 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 110
BstNSI RCATGY 1 cut(s) 68
BstV1I GCAGC 1 cut(s) 41
BstXI CCANNNNNNTGG 1 cut(s) 208
Csp6I GTAC 1 cut(s) 111
CviAII CATG 1 cut(s) 65
CviJI RGCY 1 cut(s) 54
CviKI_1 RGCY 1 cut(s) 54
CviQI GTAC 1 cut(s) 111
EcoRI GAATTC 2 cut(s) 4, 166
FaeI CATG 1 cut(s) 68
FaiI YATR 5 cut(s) 26, 66, 99, 176, 191
FaqI GGGAC 1 cut(s) 34
FatI CATG 1 cut(s) 64
Fnu4HI GCNGC 1 cut(s) 55
Fsp4HI GCNGC 1 cut(s) 55
FspBI CTAG 1 cut(s) 14
GluI GCNGC 1 cut(s) 55
GsuI CTGGAG 2 cut(s) 43, 117
Hin1II CATG 1 cut(s) 68
HinfI GANTC 1 cut(s) 115
Hpy188I TCNGA 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 60, 134
HpyAV CCTTC 1 cut(s) 11
HpyCH4III ACNGT 1 cut(s) 110
HpyCH4V TGCA 2 cut(s) 68, 73
Hsp92II CATG 1 cut(s) 68
LmnI GCTCC 1 cut(s) 62
LpnPI CCDG 2 cut(s) 73, 147
Lsp1109I GCAGC 1 cut(s) 41
MaeI CTAG 1 cut(s) 14
MaeIII GTNAC 1 cut(s) 27
MluCI AATT 3 cut(s) 4, 144, 166
MlyI GAGTC 1 cut(s) 109
MnlI CCTC 1 cut(s) 44
MseI TTAA 2 cut(s) 42, 217
Mva1269I GAATGC 1 cut(s) 202
NlaIII CATG 1 cut(s) 68
NspI RCATGY 1 cut(s) 68
PctI GAATGC 1 cut(s) 202
PkrI GCNGC 1 cut(s) 56
PleI GAGTC 1 cut(s) 109
PpsI GAGTC 1 cut(s) 109
RsaI GTAC 1 cut(s) 112
RsaNI GTAC 1 cut(s) 111
SaqAI TTAA 2 cut(s) 42, 217
SatI GCNGC 1 cut(s) 55
SchI GAGTC 1 cut(s) 109
SgeI CNNG 6 cut(s) 26, 72, 77, 86, 92, 146
Sse9I AATT 3 cut(s) 4, 144, 166
SspMI CTAG 1 cut(s) 14
TaaI ACNGT 1 cut(s) 110
TaqI TCGA 1 cut(s) 194
TasI AATT 3 cut(s) 4, 144, 166
Tru1I TTAA 2 cut(s) 42, 217
Tru9I TTAA 2 cut(s) 42, 217
TseI GCWGC 1 cut(s) 54
TspDTI ATGAA 2 cut(s) 17, 194
XapI RAATTY 2 cut(s) 4, 166
XceI RCATGY 1 cut(s) 68
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.