Rmu_sc0006355.1_g000001

Protein FLC EXPRESSOR

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006355.1
OG0000946
Physical Location & Seq
Reverse (-)
1 .. 897
897 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006355.1_g000001.1.cds

Sequence Viewer

Length: 185 bp
atgaacgccgagttgactctggtccagaatgacatcaaggacttgagcacgtcgcggatagagctcacgaccgagttgaacacgatccaaggagagattgagagggctagctccgatgagtcgaagcaaatcgaagccattagagacgaaattgagactttgaagctggagattgagaaaggaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.9

Weight (kDa)

4.3

Isoelectric Point (pI)

63.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 55
AciI CCGC 1 cut(s) 55
AclWI GGATC 1 cut(s) 79
AgsI TTSAA 2 cut(s) 79, 163
AjiI CACGTC 1 cut(s) 51
AluBI AGCT 3 cut(s) 64, 111, 166
AluI AGCT 3 cut(s) 64, 111, 166
Alw21I GWGCWC 2 cut(s) 50, 66
Alw26I GTCTC 2 cut(s) 138, 149
AlwI GGATC 1 cut(s) 79
AspS9I GGNCC 1 cut(s) 22
AsuNHI GCTAGC 1 cut(s) 107
AvaII GGWCC 1 cut(s) 22
BanII GRGCYC 1 cut(s) 66
Bbv12I GWGCWC 2 cut(s) 50, 66
BcoDI GTCTC 2 cut(s) 138, 149
BfaI CTAG 1 cut(s) 108
Bme18I GGWCC 1 cut(s) 22
BmgBI CACGTC 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 22
BmtI GCTAGC 1 cut(s) 111
BoxI GACNNNNGTC 1 cut(s) 20
BpuEI CTTGAG 1 cut(s) 64
BsaJI CCNNGG 1 cut(s) 88
BseDI CCNNGG 1 cut(s) 88
Bsh1236I CGCG 1 cut(s) 55
Bsh1285I CGRYCG 1 cut(s) 72
BsiEI CGRYCG 1 cut(s) 72
BsiHKAI GWGCWC 2 cut(s) 50, 66
BsmAI GTCTC 2 cut(s) 138, 149
BsmBI CGTCTC 1 cut(s) 138
Bsp1286I GDGCHC 2 cut(s) 50, 66
Bsp143I GATC 1 cut(s) 84
BspACI CCGC 1 cut(s) 55
BspFNI CGCG 1 cut(s) 55
BspOI GCTAGC 1 cut(s) 111
BspPI GGATC 1 cut(s) 79
BssECI CCNNGG 1 cut(s) 88
BssMI GATC 1 cut(s) 84
BssT1I CCWWGG 1 cut(s) 88
BstC8I GCNNGC 1 cut(s) 109
BstFNI CGCG 1 cut(s) 55
BstKTI GATC 1 cut(s) 87
BstMAI GTCTC 2 cut(s) 138, 149
BstMBI GATC 1 cut(s) 84
BstMCI CGRYCG 1 cut(s) 72
BstMWI GCNNNNNNNGC 1 cut(s) 61
BstPAI GACNNNNGTC 1 cut(s) 20
BstUI CGCG 1 cut(s) 55
BtrI CACGTC 1 cut(s) 51
Cac8I GCNNGC 1 cut(s) 109
Cfr13I GGNCC 1 cut(s) 22
CviJI RGCY 5 cut(s) 64, 107, 111, 137, 166
CviKI_1 RGCY 5 cut(s) 64, 107, 111, 137, 166
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
Ecl136II GAGCTC 1 cut(s) 64
Eco130I CCWWGG 1 cut(s) 88
Eco24I GRGCYC 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 22
Eco53kI GAGCTC 1 cut(s) 64
EcoICRI GAGCTC 1 cut(s) 64
EcoT14I CCWWGG 1 cut(s) 88
EcoT38I GRGCYC 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 88
Esp3I CGTCTC 1 cut(s) 138
FriOI GRGCYC 1 cut(s) 66
FspBI CTAG 1 cut(s) 108
HincII GTYRAC 1 cut(s) 15
HindII GTYRAC 1 cut(s) 15
HinfI GANTC 2 cut(s) 16, 119
Hpy166II GTNNAC 1 cut(s) 15
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 25, 67
Hpy8I GTNNAC 1 cut(s) 15
Hpy99I CGWCG 1 cut(s) 55
HpyCH4IV ACGT 1 cut(s) 50
HpyF10VI GCNNNNNNNGC 1 cut(s) 61
HpySE526I ACGT 1 cut(s) 50
Kzo9I GATC 1 cut(s) 84
LmnI GCTCC 1 cut(s) 116
LpnPI CCDG 3 cut(s) 5, 38, 152
MaeI CTAG 1 cut(s) 108
MaeII ACGT 1 cut(s) 50
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MhlI GDGCHC 2 cut(s) 50, 66
MluCI AATT 1 cut(s) 150
MlyI GAGTC 2 cut(s) 10, 128
MnlI CCTC 1 cut(s) 96
MvnI CGCG 1 cut(s) 55
MwoI GCNNNNNNNGC 1 cut(s) 61
NdeII GATC 1 cut(s) 84
NheI GCTAGC 1 cut(s) 107
NmeAIII GCCGAG 1 cut(s) 34
PleI GAGTC 2 cut(s) 10, 127
PpsI GAGTC 2 cut(s) 10, 127
PshAI GACNNNNGTC 1 cut(s) 20
Psp124BI GAGCTC 1 cut(s) 66
PspPI GGNCC 1 cut(s) 22
SacI GAGCTC 1 cut(s) 66
Sau3AI GATC 1 cut(s) 84
Sau96I GGNCC 1 cut(s) 22
SchI GAGTC 2 cut(s) 10, 128
SduI GDGCHC 2 cut(s) 50, 66
SetI ASST 4 cut(s) 53, 66, 113, 168
SinI GGWCC 1 cut(s) 22
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 1 cut(s) 150
SsiI CCGC 1 cut(s) 55
SspMI CTAG 1 cut(s) 108
SstI GAGCTC 1 cut(s) 66
StyI CCWWGG 1 cut(s) 88
TaiI ACGT 1 cut(s) 53
TaqI TCGA 2 cut(s) 122, 132
TaqII GACCGA 1 cut(s) 86
TasI AATT 1 cut(s) 150
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 22
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.