Rh1AG197900

Protein FLC EXPRESSOR

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0000946
Physical Location & Seq
Reverse (-)
37627462 .. 37627650
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG197900.1

Sequence Viewer

Length: 189 bp
ATGAAAGCCGAGTTGACTATGGTCCGAAACGACATCGAGGACTTGAGCAAGTCGCTGATGGAGCTTGTGACCAAGTTGAAGACGATCCAAAGAGAGAATGAGAGGGCTCGGTCCGACAAGTCGAAGAAAATCGAAGCCATTAGAGACGAAATTGAGACTTTGAAGTTGGAGATTGAGAAAGGAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.3

Weight (kDa)

8.01

Isoelectric Point (pI)

45.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 79
AgsI TTSAA 2 cut(s) 79, 163
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
Alw26I GTCTC 2 cut(s) 138, 149
AlwI GGATC 1 cut(s) 79
AspS9I GGNCC 2 cut(s) 22, 111
AvaII GGWCC 2 cut(s) 22, 111
BanII GRGCYC 1 cut(s) 109
BbsI GAAGAC 1 cut(s) 86
BccI CCATC 1 cut(s) 52
BcoDI GTCTC 2 cut(s) 138, 149
Bme18I GGWCC 2 cut(s) 22, 111
BmgT120I GGNCC 2 cut(s) 22, 111
BoxI GACNNNNGTC 1 cut(s) 20
BpiI GAAGAC 1 cut(s) 86
BpuEI CTTGAG 1 cut(s) 64
BsmAI GTCTC 2 cut(s) 138, 149
BsmBI CGTCTC 1 cut(s) 138
Bsp1286I GDGCHC 1 cut(s) 109
Bsp143I GATC 1 cut(s) 84
BspPI GGATC 1 cut(s) 79
BssMI GATC 1 cut(s) 84
BstKTI GATC 1 cut(s) 87
BstMAI GTCTC 2 cut(s) 138, 149
BstMBI GATC 1 cut(s) 84
BstMWI GCNNNNNNNGC 1 cut(s) 61
BstPAI GACNNNNGTC 1 cut(s) 20
BstV2I GAAGAC 1 cut(s) 86
Cfr13I GGNCC 2 cut(s) 22, 111
CpoI CGGWCCG 1 cut(s) 111
CspI CGGWCCG 1 cut(s) 111
CviJI RGCY 4 cut(s) 8, 64, 107, 137
CviKI_1 RGCY 4 cut(s) 8, 64, 107, 137
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
Eco24I GRGCYC 1 cut(s) 109
Eco47I GGWCC 2 cut(s) 22, 111
EcoT38I GRGCYC 1 cut(s) 109
Esp3I CGTCTC 1 cut(s) 138
FaiI YATR 1 cut(s) 20
FriOI GRGCYC 1 cut(s) 109
HincII GTYRAC 1 cut(s) 15
HindII GTYRAC 1 cut(s) 15
Hpy166II GTNNAC 1 cut(s) 15
Hpy188I TCNGA 2 cut(s) 26, 115
Hpy8I GTNNAC 1 cut(s) 15
HpyAV CCTTC 1 cut(s) 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 61
Kzo9I GATC 1 cut(s) 84
LmnI GCTCC 1 cut(s) 61
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 2 cut(s) 91, 136
MhlI GDGCHC 1 cut(s) 109
MluCI AATT 1 cut(s) 150
MmeI TCCRAC 2 cut(s) 138, 147
MnlI CCTC 2 cut(s) 31, 96
MwoI GCNNNNNNNGC 1 cut(s) 61
NdeII GATC 1 cut(s) 84
NmeAIII GCCGAG 1 cut(s) 34
NmuCI GTSAC 1 cut(s) 67
PshAI GACNNNNGTC 1 cut(s) 20
PspPI GGNCC 2 cut(s) 22, 111
Rsr2I CGGWCCG 1 cut(s) 111
RsrII CGGWCCG 1 cut(s) 111
Sau3AI GATC 1 cut(s) 84
Sau96I GGNCC 2 cut(s) 22, 111
SduI GDGCHC 1 cut(s) 109
SetI ASST 2 cut(s) 66, 188
SgeI CNNG 8 cut(s) 22, 49, 55, 61, 77, 85, 120, 130
SinI GGWCC 2 cut(s) 22, 111
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 1 cut(s) 150
TaqI TCGA 3 cut(s) 36, 122, 132
TaqII GACCGA 1 cut(s) 99
TasI AATT 1 cut(s) 150
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 2 cut(s) 22, 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.