Rh6AG291600

Protein FLC EXPRESSOR

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Reverse (-)
48846345 .. 48846533
189 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG291600.1

Sequence Viewer

Length: 189 bp
ATGAAAGCCGAGTTGACTCTGGTCCGGAACGACATCGAGGACTTGAGCAAGTCGCTGATACAGCTCGTGACCAAGTTGAAGACGATCCAAAGAGAGAATGAGAGGGCTCGGTCCGACGAGTCAAAGCAAATCGAAGCCATTAGAGACGAAATTGAGACTTTGAAGTTGGAGATTGAGAAAGGAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.27

Weight (kDa)

5.47

Isoelectric Point (pI)

55.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 24
AclWI GGATC 1 cut(s) 79
AgsI TTSAA 2 cut(s) 79, 163
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
Alw26I GTCTC 2 cut(s) 138, 149
AlwI GGATC 1 cut(s) 79
Aor13HI TCCGGA 1 cut(s) 24
AspS9I GGNCC 2 cut(s) 22, 111
AvaII GGWCC 2 cut(s) 22, 111
BanII GRGCYC 1 cut(s) 109
BauI CACGAG 1 cut(s) 65
BbsI GAAGAC 1 cut(s) 86
BcoDI GTCTC 2 cut(s) 138, 149
Bme18I GGWCC 2 cut(s) 22, 111
BmgT120I GGNCC 2 cut(s) 22, 111
BoxI GACNNNNGTC 1 cut(s) 20
BpiI GAAGAC 1 cut(s) 86
BpuEI CTTGAG 1 cut(s) 64
BsaWI WCCGGW 1 cut(s) 24
BseAI TCCGGA 1 cut(s) 24
BsiSI CCGG 1 cut(s) 25
BsmAI GTCTC 2 cut(s) 138, 149
BsmBI CGTCTC 1 cut(s) 138
Bsp1286I GDGCHC 1 cut(s) 109
Bsp13I TCCGGA 1 cut(s) 24
Bsp143I GATC 1 cut(s) 84
BspEI TCCGGA 1 cut(s) 24
BspPI GGATC 1 cut(s) 79
BssMI GATC 1 cut(s) 84
BssSI CACGAG 1 cut(s) 65
Bst2BI CACGAG 1 cut(s) 65
BstKTI GATC 1 cut(s) 87
BstMAI GTCTC 2 cut(s) 138, 149
BstMBI GATC 1 cut(s) 84
BstMWI GCNNNNNNNGC 1 cut(s) 61
BstPAI GACNNNNGTC 1 cut(s) 20
BstV2I GAAGAC 1 cut(s) 86
Cfr13I GGNCC 2 cut(s) 22, 111
CpoI CGGWCCG 1 cut(s) 111
CspI CGGWCCG 1 cut(s) 111
CviJI RGCY 4 cut(s) 8, 64, 107, 137
CviKI_1 RGCY 4 cut(s) 8, 64, 107, 137
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
Eco24I GRGCYC 1 cut(s) 109
Eco47I GGWCC 2 cut(s) 22, 111
EcoT38I GRGCYC 1 cut(s) 109
Esp3I CGTCTC 1 cut(s) 138
FriOI GRGCYC 1 cut(s) 109
HapII CCGG 1 cut(s) 25
HincII GTYRAC 1 cut(s) 15
HindII GTYRAC 1 cut(s) 15
HinfI GANTC 2 cut(s) 16, 119
HpaII CCGG 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 15
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 25, 67
Hpy8I GTNNAC 1 cut(s) 15
Hpy99I CGWCG 1 cut(s) 119
HpyAV CCTTC 1 cut(s) 177
HpyF10VI GCNNNNNNNGC 1 cut(s) 61
Kpn2I TCCGGA 1 cut(s) 24
Kzo9I GATC 1 cut(s) 84
LpnPI CCDG 2 cut(s) 5, 38
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 1 cut(s) 91
MhlI GDGCHC 1 cut(s) 109
MluCI AATT 1 cut(s) 150
MlyI GAGTC 2 cut(s) 10, 128
MmeI TCCRAC 2 cut(s) 138, 147
MnlI CCTC 2 cut(s) 31, 96
MroI TCCGGA 1 cut(s) 24
MspI CCGG 1 cut(s) 25
MwoI GCNNNNNNNGC 1 cut(s) 61
NdeII GATC 1 cut(s) 84
NmeAIII GCCGAG 1 cut(s) 34
NmuCI GTSAC 1 cut(s) 67
PleI GAGTC 2 cut(s) 10, 127
PpsI GAGTC 2 cut(s) 10, 127
PshAI GACNNNNGTC 1 cut(s) 20
PspPI GGNCC 2 cut(s) 22, 111
Rsr2I CGGWCCG 1 cut(s) 111
RsrII CGGWCCG 1 cut(s) 111
Sau3AI GATC 1 cut(s) 84
Sau96I GGNCC 2 cut(s) 22, 111
SchI GAGTC 2 cut(s) 10, 128
SduI GDGCHC 1 cut(s) 109
SetI ASST 2 cut(s) 66, 188
SinI GGWCC 2 cut(s) 22, 111
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 1 cut(s) 150
TaqI TCGA 2 cut(s) 36, 132
TaqII GACCGA 1 cut(s) 99
TasI AATT 1 cut(s) 150
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 2 cut(s) 22, 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.