Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0008034.1

Orthogroup ID

OG0001461

Physical Location & Seq

Genomic Coordinates Forward (+)

21272 .. 23550

Gene Structure 2279 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0008034.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 930 bp

atggagtttccagctgcagatgctgatgacaatcctcaagacaacgggcctcagatgatgggtgagattaggtgtccgataactggaattgttatcaacacatatttggcaccacctggtgataaccaggactatgccatcaagaaaattcccattggagaagtgattgaagatgatcccgattcacaagctttcagctatgcatctcttgtaagggaggcgagagtatggtcccagcttaatcaccggaatatcgtccgatactatgagtcttggactgaaaacaagtactgcggtttgctggatgaagattgggatggggacccaatagaaacagaaaatccatgcttgtacattcaattggaactatgtgacagttccttggaacgcaagctgcagccaaatgaacaatgcatgaacaattggacaaccagagaagagtgtgcacagatttttgaagaacttgtgaaaggtttcaaccacattcatggcaaagggataatgcacggagatatcaccaaggcaaacattctcttctgcaatggtgaagccaaaatctctgattttggactagcccgaacaattggggcaaagaatgatgaggttgacatgaaggcgttccgaccttatagagcacctgagaggaagaccgctgatgcagatgtcaaggctgatatatacagcttgggaatccttttattcgagatgctacagcccttcacaacagatagccacagaggtgttgttcttactgccttgagggatatgaaaatctttccgaaaggctggactgataacccggtaaggaaatgggtgctgggaatgataaataatgccccatcagaaagaccctcagcatcatatcttctgcaccaccgtgaaaggattaaggccgatattctaaggtctgaggcaatgcccagtgaatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase

Protein Analysis

309

Amino Acids

35.17

Weight (kDa)

4.93

Isoelectric Point (pI)

45.65

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001461)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g14230 FvH4_1g14282
prunus_persica	Prupe.7G151400_v2.0.a1 Prupe.7G151400_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0102471 RchiOBHm_Chr2g0102541 RchiOBHm_Chr2g0102571 RchiOBHm_Chr2g0102911
rosa_laevigata	RLG00000017150 RLG00000017151 RLG00000017153 RLG00000017166 RLG00000017169 RLG00000017171
rosa_multiflora	Rmu_co8249631.1_g000001 Rmu_sc0006537.1_g000001 Rmu_sc0008034.1_g000008 Rmu_sc0033667.1_g000001
rosa_roxburghii	Rroxscaffold_2G00140380 Rroxscaffold_2G00140480 Rroxscaffold_2G00140490 Rroxscaffold_4G00310880 Rroxscaffold_4G00310920
rosa_rugosa	Rorug02G0107800 Rorug02G0107800 Rorug02G0108700 Rorug02G0109200
rosa_samantha	Rh1AG182000 Rh1CG168800 Rh2AG155700 Rh2AG156200 Rh2AG156600 Rh2AG156800 Rh2BG162000 Rh2BG162500 Rh2BG162600 Rh2BG162800 Rh2BG163000 Rh2BG163100 Rh2CG161200 Rh2CG161500 Rh2CG161600 Rh2CG161900 Rh2CG163100 Rh2CG163400 Rh2CG165200 Rh2DG161200 Rh2DG161700 Rh2DG161900
rosa_wichuraiana	Rw2G012140 Rw2G012150 Rw2G012360

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	109
AciI	CCGC	2 cut(s)	294, 651
AclWI	GGATC	1 cut(s)	170
AcsI	RAATTY	1 cut(s)	147
AdeI	CACNNNGTG	1 cut(s)	119
AfaI	GTAC	2 cut(s)	290, 353
AfiI	CCNNNNNNNGG	1 cut(s)	83
AgsI	TTSAA	4 cut(s)	170, 359, 458, 478
AjnI	CCWGG	2 cut(s)	115, 126
AleI	CACNNNNGTG	2 cut(s)	738, 876
AluBI	AGCT	6 cut(s)	14, 191, 198, 238, 394, 684
AluI	AGCT	6 cut(s)	14, 191, 198, 238, 394, 684
Alw21I	GWGCWC	2 cut(s)	448, 637
Alw44I	GTGCAC	1 cut(s)	444
AlwI	GGATC	1 cut(s)	170
AlwNI	CAGNNNCTG	1 cut(s)	23
AoxI	GGCC	2 cut(s)	47, 891
ApaLI	GTGCAC	1 cut(s)	444
ApeKI	GCWGC	3 cut(s)	14, 394, 397
ApoI	RAATTY	1 cut(s)	147
Asp700I	GAANNNNTTC	2 cut(s)	473, 617
AspS9I	GGNCC	3 cut(s)	47, 231, 322
AsuC2I	CCSGG	1 cut(s)	800
AsuHPI	GGTGA	5 cut(s)	74, 131, 236, 508, 557
AvaII	GGWCC	2 cut(s)	231, 322
BaeGI	GKGCMC	1 cut(s)	448
BanI	GGYRCC	1 cut(s)	109
BbsI	GAAGAC	1 cut(s)	653
Bbv12I	GWGCWC	2 cut(s)	448, 637
BbvCI	CCTCAGC	1 cut(s)	853
BbvI	GCAGC	2 cut(s)	381, 409
BccI	CCATC	4 cut(s)	52, 146, 311, 847
BciT130I	CCWGG	2 cut(s)	117, 128
BcnI	CCSGG	1 cut(s)	800
BfaI	CTAG	1 cut(s)	572
BfmI	CTRYAG	3 cut(s)	15, 395, 710
BisI	GCNGC	3 cut(s)	15, 395, 398
BlsI	GCNGC	3 cut(s)	16, 396, 399
BmcAI	AGTACT	1 cut(s)	290
Bme1390I	CCNGG	3 cut(s)	117, 128, 800
Bme18I	GGWCC	2 cut(s)	231, 322
BmgT120I	GGNCC	3 cut(s)	47, 231, 322
BmiI	GGNNCC	4 cut(s)	111, 233, 323, 324
BmrFI	CCNGG	3 cut(s)	117, 128, 800
BmrI	ACTGGG	1 cut(s)	915
BmsI	GCATC	5 cut(s)	10, 212, 646, 696, 866
BmuI	ACTGGG	1 cut(s)	915
BpiI	GAAGAC	1 cut(s)	653
Bpu10I	CCTNAGC	1 cut(s)	853
BpuEI	CTTGAG	2 cut(s)	21, 778
BpuMI	CCSGG	1 cut(s)	800
BsaBI	GATNNNNATC	1 cut(s)	30
BsaJI	CCNNGG	2 cut(s)	381, 519
BsaWI	WCCGGW	1 cut(s)	246
Bsc4I	CCNNNNNNNGG	1 cut(s)	83
Bse1I	ACTGG	2 cut(s)	88, 921
Bse3DI	GCAATG	2 cut(s)	547, 921
Bse8I	GATNNNNATC	1 cut(s)	30
BseBI	CCWGG	2 cut(s)	117, 128
BseDI	CCNNGG	2 cut(s)	381, 519
BseGI	GGATG	2 cut(s)	310, 322
BseJI	GATNNNNATC	1 cut(s)	30
BseLI	CCNNNNNNNGG	1 cut(s)	83
BseMI	GCAATG	2 cut(s)	547, 921
BseMII	CTCAG	4 cut(s)	65, 630, 867, 900
BseNI	ACTGG	2 cut(s)	88, 921
BseSI	GKGCMC	1 cut(s)	448
BseXI	GCAGC	2 cut(s)	381, 409
BseYI	CCCAGC	2 cut(s)	234, 817
BsgI	GTGCAG	1 cut(s)	854
BshFI	GGCC	2 cut(s)	49, 893
BshNI	GGYRCC	1 cut(s)	109
BsiHKAI	GWGCWC	2 cut(s)	448, 637
BsiSI	CCGG	2 cut(s)	247, 800
BslFI	GGGAC	2 cut(s)	217, 335
BslI	CCNNNNNNNGG	1 cut(s)	83
BsmFI	GGGAC	2 cut(s)	217, 335
BsnI	GGCC	2 cut(s)	49, 893
Bsp1286I	GDGCHC	2 cut(s)	448, 637
Bsp1407I	TGTACA	1 cut(s)	351
Bsp143I	GATC	1 cut(s)	175
BspACI	CCGC	2 cut(s)	294, 651
BspANI	GGCC	2 cut(s)	49, 893
BspCNI	CTCAG	4 cut(s)	64, 631, 866, 901
BspLI	GGNNCC	4 cut(s)	111, 233, 323, 324
BspMAI	CTGCAG	2 cut(s)	19, 399
BspPI	GGATC	1 cut(s)	170
BspT107I	GGYRCC	1 cut(s)	109
BsrDI	GCAATG	2 cut(s)	547, 921
BsrGI	TGTACA	1 cut(s)	351
BsrI	ACTGG	2 cut(s)	88, 921
BssECI	CCNNGG	2 cut(s)	381, 519
BssMI	GATC	1 cut(s)	175
BssT1I	CCWWGG	2 cut(s)	381, 519
Bst2UI	CCWGG	2 cut(s)	117, 128
Bst4CI	ACNGT	2 cut(s)	377, 878
Bst6I	CTCTTC	2 cut(s)	432, 539
BstAUI	TGTACA	1 cut(s)	351
BstC8I	GCNNGC	1 cut(s)	392
BstDEI	CTNAG	5 cut(s)	51, 639, 853, 902, 909
BstF5I	GGATG	2 cut(s)	310, 322
BstKTI	GATC	1 cut(s)	178
BstMBI	GATC	1 cut(s)	175
BstMWI	GCNNNNNNNGC	1 cut(s)	20
BstNI	CCWGG	2 cut(s)	117, 128
BstSCI	CCNGG	3 cut(s)	115, 126, 798
BstSFI	CTRYAG	3 cut(s)	15, 395, 710
BstSLI	GKGCMC	1 cut(s)	448
BstV1I	GCAGC	2 cut(s)	381, 409
BstV2I	GAAGAC	1 cut(s)	653
BstXI	CCANNNNNNTGG	1 cut(s)	488
BsuRI	GGCC	2 cut(s)	49, 893
BtsCI	GGATG	2 cut(s)	310, 322
BtsIMutI	CAGTG	1 cut(s)	928
Cac8I	GCNNGC	1 cut(s)	392
CaiI	CAGNNNCTG	1 cut(s)	23
Cfr13I	GGNCC	3 cut(s)	47, 231, 322
CsiI	ACCWGGT	1 cut(s)	115
Csp6I	GTAC	2 cut(s)	289, 352
CviAII	CATG	4 cut(s)	345, 415, 488, 610
CviQI	GTAC	2 cut(s)	289, 352
DdeI	CTNAG	5 cut(s)	51, 639, 853, 902, 909
DpnI	GATC	1 cut(s)	177
DpnII	GATC	1 cut(s)	175
DraIII	CACNNNGTG	1 cut(s)	119
Eam1104I	CTCTTC	2 cut(s)	432, 539
EarI	CTCTTC	2 cut(s)	432, 539
Eco130I	CCWWGG	2 cut(s)	381, 519
Eco32I	GATATC	1 cut(s)	514
Eco47I	GGWCC	2 cut(s)	231, 322
EcoO109I	RGGNCCY	1 cut(s)	322
EcoRII	CCWGG	2 cut(s)	115, 126
EcoRV	GATATC	1 cut(s)	514
EcoT14I	CCWWGG	2 cut(s)	381, 519
EcoT22I	ATGCAT	2 cut(s)	205, 416
ErhI	CCWWGG	2 cut(s)	381, 519
FaeI	CATG	4 cut(s)	348, 418, 491, 613
FaqI	GGGAC	2 cut(s)	217, 335
FatI	CATG	4 cut(s)	344, 414, 487, 609
Fnu4HI	GCNGC	3 cut(s)	15, 395, 398
FokI	GGATG	2 cut(s)	317, 329
Fsp4HI	GCNGC	3 cut(s)	15, 395, 398
FspBI	CTAG	1 cut(s)	572
GluI	GCNGC	3 cut(s)	15, 395, 398
GsaI	CCCAGC	2 cut(s)	238, 821
HaeIII	GGCC	2 cut(s)	49, 893
HapII	CCGG	2 cut(s)	247, 800
Hin1II	CATG	4 cut(s)	348, 418, 491, 613
HincII	GTYRAC	1 cut(s)	607
HindII	GTYRAC	1 cut(s)	607
HindIII	AAGCTT	1 cut(s)	189
HinfI	GANTC	3 cut(s)	182, 269, 690
HpaII	CCGG	2 cut(s)	247, 800
HphI	GGTGA	5 cut(s)	74, 131, 236, 508, 557
Hpy166II	GTNNAC	2 cut(s)	446, 607
Hpy188I	TCNGA	8 cut(s)	54, 78, 260, 562, 623, 780, 844, 910
Hpy188III	TCNNGA	4 cut(s)	38, 142, 179, 703
Hpy8I	GTNNAC	2 cut(s)	446, 607
HpyAV	CCTTC	2 cut(s)	607, 727
HpyCH4III	ACNGT	2 cut(s)	377, 878
HpyCH4V	TGCA	9 cut(s)	17, 203, 397, 414, 446, 505, 540, 659, 871
HpyF10VI	GCNNNNNNNGC	1 cut(s)	20
HpyF3I	CTNAG	5 cut(s)	51, 639, 853, 902, 909
Hsp92II	CATG	4 cut(s)	348, 418, 491, 613
KflI	GGGWCCC	1 cut(s)	322
Kzo9I	GATC	1 cut(s)	175
Lsp1109I	GCAGC	2 cut(s)	381, 409
LweI	GCATC	5 cut(s)	10, 212, 646, 696, 866
MabI	ACCWGGT	1 cut(s)	115
MaeI	CTAG	1 cut(s)	572
MaeIII	GTNAC	1 cut(s)	371
MalI	GATC	1 cut(s)	177
MboI	GATC	1 cut(s)	175
MboII	GAAGA	7 cut(s)	182, 320, 449, 470, 526, 658, 857
MfeI	CAATTG	3 cut(s)	359, 421, 582
MhlI	GDGCHC	2 cut(s)	448, 637
MluCI	AATT	5 cut(s)	87, 147, 359, 421, 582
MlyI	GAGTC	1 cut(s)	278
MmeI	TCCRAC	1 cut(s)	646
MnlI	CCTC	9 cut(s)	45, 60, 211, 595, 636, 731, 753, 862, 904
Mph1103I	ATGCAT	2 cut(s)	205, 416
MroXI	GAANNNNTTC	2 cut(s)	473, 617
MseI	TTAA	2 cut(s)	240, 888
MslI	CAYNNNNRTG	3 cut(s)	486, 738, 876
MspA1I	CMGCKG	2 cut(s)	14, 653
MspI	CCGG	2 cut(s)	247, 800
MspR9I	CCNGG	3 cut(s)	117, 128, 800
MunI	CAATTG	3 cut(s)	359, 421, 582
MvaI	CCWGG	2 cut(s)	117, 128
MwoI	GCNNNNNNNGC	1 cut(s)	20
NciI	CCSGG	1 cut(s)	800
NdeII	GATC	1 cut(s)	175
NlaIII	CATG	4 cut(s)	348, 418, 491, 613
NlaIV	GGNNCC	4 cut(s)	111, 233, 323, 324
NmuCI	GTSAC	1 cut(s)	371
NsiI	ATGCAT	2 cut(s)	205, 416
OliI	CACNNNNGTG	2 cut(s)	738, 876
PdmI	GAANNNNTTC	2 cut(s)	473, 617
PfeI	GAWTC	2 cut(s)	182, 690
PkrI	GCNGC	3 cut(s)	16, 396, 399
PleI	GAGTC	1 cut(s)	277
PpsI	GAGTC	1 cut(s)	277
PpuMI	RGGWCCY	1 cut(s)	322
Psp5II	RGGWCCY	1 cut(s)	322
Psp6I	CCWGG	2 cut(s)	115, 126
PspFI	CCCAGC	2 cut(s)	234, 817
PspGI	CCWGG	2 cut(s)	115, 126
PspN4I	GGNNCC	4 cut(s)	111, 233, 323, 324
PspPI	GGNCC	3 cut(s)	47, 231, 322
PspPPI	RGGWCCY	1 cut(s)	322
PstI	CTGCAG	2 cut(s)	19, 399
PstNI	CAGNNNCTG	1 cut(s)	23
PvuII	CAGCTG	1 cut(s)	14
RsaI	GTAC	2 cut(s)	290, 353
RsaNI	GTAC	2 cut(s)	289, 352
RseI	CAYNNNNRTG	3 cut(s)	486, 738, 876
SaqAI	TTAA	2 cut(s)	240, 888
SatI	GCNGC	3 cut(s)	15, 395, 398
Sau3AI	GATC	1 cut(s)	175
Sau96I	GGNCC	3 cut(s)	47, 231, 322
ScaI	AGTACT	1 cut(s)	290
SchI	GAGTC	1 cut(s)	278
ScrFI	CCNGG	3 cut(s)	117, 128, 800
SduI	GDGCHC	2 cut(s)	448, 637
SexAI	ACCWGGT	1 cut(s)	115
SfaNI	GCATC	5 cut(s)	10, 212, 646, 696, 866
SfcI	CTRYAG	3 cut(s)	15, 395, 710
SinI	GGWCC	2 cut(s)	231, 322
SmiMI	CAYNNNNRTG	3 cut(s)	486, 738, 876
SmlI	CTYRAG	2 cut(s)	36, 757
SmoI	CTYRAG	2 cut(s)	36, 757
Sse9I	AATT	5 cut(s)	87, 147, 359, 421, 582
SsiI	CCGC	2 cut(s)	294, 651
SspMI	CTAG	1 cut(s)	572
StyD4I	CCNGG	3 cut(s)	115, 126, 798
StyI	CCWWGG	2 cut(s)	381, 519
TaaI	ACNGT	2 cut(s)	377, 878
TaqI	TCGA	1 cut(s)	702
TasI	AATT	5 cut(s)	87, 147, 359, 421, 582
TatI	WGTACW	2 cut(s)	288, 351
TfiI	GAWTC	2 cut(s)	182, 690
Tru1I	TTAA	2 cut(s)	240, 888
Tru9I	TTAA	2 cut(s)	240, 888
TscAI	CASTG	1 cut(s)	928
TseFI	GTSAC	1 cut(s)	371
TseI	GCWGC	3 cut(s)	14, 394, 397
Tsp45I	GTSAC	1 cut(s)	371
TspDTI	ATGAA	6 cut(s)	321, 420, 431, 476, 626, 782
TspGWI	ACGGA	1 cut(s)	522
TspRI	CASTG	1 cut(s)	928
VneI	GTGCAC	1 cut(s)	444
VpaK11BI	GGWCC	2 cut(s)	231, 322
XapI	RAATTY	1 cut(s)	147
XmnI	GAANNNNTTC	2 cut(s)	473, 617
XspI	CTAG	1 cut(s)	572
ZrmI	AGTACT	1 cut(s)	290
Zsp2I	ATGCAT	2 cut(s)	205, 416

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.