Rmu_sc0011003.1_g000003

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011003.1
Physical Location & Seq
Forward (+)
8078 .. 11041
2964 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011003.1_g000003.1.cds

Sequence Viewer

Length: 636 bp
atgggggatttgtacgctttggatttcgacggagttctgtgcgatagctgcggagagggctatgcctctgctgccaaggctgctaaagtgatatggccaacgctattcaacgatgtggattcaagtttagaggattggcttgtcgatcaagtccgcacagtgagacctgtgctgcaaaagcggtatgacaatcttctacttgtgaggttacttttggagatgaggcttccttctttaagaaagtcatcagttgcagaagggctcacggtggaagggatagtggagaattggttagagttgaagaatctgattttgaaggaatggggtgaggatagggatgctcttttaaattcatatggaaaggtcagggatgagtggagggttcaggacttgaaaacttggatcggtgcaaatagattgtatccaggtgttgctgatgctcttaaatcggcaacctcagccatttacattgtcactgggaaacagagcccatttgctgaggtaatactacaagaatttgcaaaagatacaataccgcctgaaagaatatttggtgttgctagttgcagccacaagatagaaatactgaagcagcttcaagagaaagcagaacatcaagggctgaagctgcagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

211

Amino Acids

23.76

Weight (kDa)

5.22

Isoelectric Point (pI)

39.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000506)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G45990 AT2G45990 AT2G45990 AT2G45990
fragaria_vesca FvH4_3g44250 FvH4_3g44250 FvH4_3g44250 FvH4_3g44250 FvH4_3g44250 FvH4_7g14540 FvH4_7g14540 FvH4_7g14540 FvH4_7g14540 FvH4_7g14540 FvH4_7g14540 FvH4_7g14540 FvH4_7g14540 FvH4_7g14571 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620 FvH4_7g14620
malus_domestica MD01G1065200.v1.1 MD09G1245400.v1.1
prunus_persica Prupe.2G172200_v2.0.a1
pyrus_communis pycom01g09450
rosa_chinensis RchiOBHm_Chr1g0355961 RchiOBHm_Chr1g0356011 RchiOBHm_Chr1g0356041 RchiOBHm_Chr1g0356051 RchiOBHm_Chr1g0356101 RchiOBHm_Chr1g0356141
rosa_laevigata RLG00000028102 RLG00000028107 RLG00000028108 RLG00000028110 RLG00000028112
rosa_multiflora Rmu_sc0002569.1_g000001 Rmu_sc0002569.1_g000022 Rmu_sc0003229.1_g000002 Rmu_sc0004705.1_g000007 Rmu_sc0007127.1_g000003 Rmu_sc0007127.1_g000007 Rmu_sc0011003.1_g000003 Rmu_sc0014206.1_g000012
rosa_roxburghii Rroxscaffold_4G00299780 Rroxscaffold_4G00299790 Rroxscaffold_4G00299810 Rroxscaffold_4G00299820 Rroxscaffold_4G00299870 Rroxscaffold_4G00299890
rosa_rugosa Rorug01G0249000 Rorug01G0249200 Rorug01G0249300 Rorug01G0249400 Rorug01G0249400 Rorug01G0249500 Rorug01G0249600
rosa_samantha Rh1BG230700 Rh1BG230800 Rh1BG230900 Rh1BG231200 Rh1BG231300 Rh1CG041500 Rh1CG244900 Rh1CG245500 Rh1CG245600 Rh1CG246100 Rh1CG246200 Rh1DG028400 Rh1DG258800 Rh1DG258900 Rh1DG259000
rosa_wichuraiana Rw1G023130 Rw1G023160 Rw1G023170 Rw1G023180 Rw1G023220 Rw1G023230

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 51, 154, 181, 536
AclWI GGATC 1 cut(s) 410
AcoI YGGCCR 1 cut(s) 95
AcsI RAATTY 2 cut(s) 349, 515
AcuI CTGAAG 1 cut(s) 608
AfaI GTAC 1 cut(s) 14
AgsI TTSAA 6 cut(s) 109, 123, 301, 316, 394, 599
AjnI CCWGG 1 cut(s) 424
AjuI GAANNNNNNNTTGG 2 cut(s) 534, 566
AluBI AGCT 3 cut(s) 48, 595, 628
AluI AGCT 3 cut(s) 48, 595, 628
Alw26I GTCTC 1 cut(s) 157
AlwI GGATC 1 cut(s) 410
AoxI GGCC 1 cut(s) 95
ApeKI GCWGC 7 cut(s) 48, 71, 80, 172, 567, 592, 628
ApoI RAATTY 2 cut(s) 349, 515
AsuHPI GGTGA 1 cut(s) 338
BalI TGGCCA 1 cut(s) 97
BanII GRGCYC 2 cut(s) 264, 491
BbvCI CCTCAGC 2 cut(s) 457, 498
BbvI GCAGC 7 cut(s) 35, 58, 67, 159, 579, 604, 615
BciT130I CCWGG 1 cut(s) 426
BciVI GTATCC 1 cut(s) 432
BcoDI GTCTC 1 cut(s) 157
BfaI CTAG 1 cut(s) 561
BfmI CTRYAG 1 cut(s) 629
BfuI GTATCC 1 cut(s) 432
BisI GCNGC 7 cut(s) 49, 72, 81, 173, 568, 593, 629
BlsI GCNGC 7 cut(s) 50, 73, 82, 174, 569, 594, 630
Bme1390I CCNGG 1 cut(s) 426
BmrFI CCNGG 1 cut(s) 426
BmrI ACTGGG 1 cut(s) 486
BmsI GCATC 2 cut(s) 328, 427
BmuI ACTGGG 1 cut(s) 486
Bpu10I CCTNAGC 2 cut(s) 457, 498
BsaI GGTCTC 1 cut(s) 157
BsaJI CCNNGG 1 cut(s) 75
BsaXI ACNNNNNCTCC 2 cut(s) 275, 305
Bse1I ACTGG 1 cut(s) 481
BseBI CCWGG 1 cut(s) 426
BseDI CCNNGG 1 cut(s) 75
BseGI GGATG 2 cut(s) 343, 376
BseMII CTCAG 2 cut(s) 471, 489
BseNI ACTGG 1 cut(s) 481
BseXI GCAGC 7 cut(s) 35, 58, 67, 159, 579, 604, 615
BshFI GGCC 1 cut(s) 97
BsmAI GTCTC 1 cut(s) 157
BsnI GGCC 1 cut(s) 97
Bso31I GGTCTC 1 cut(s) 157
Bsp1286I GDGCHC 2 cut(s) 264, 491
Bsp143I GATC 2 cut(s) 145, 402
BspACI CCGC 4 cut(s) 51, 154, 181, 536
BspANI GGCC 1 cut(s) 97
BspCNI CTCAG 2 cut(s) 470, 490
BspMAI CTGCAG 1 cut(s) 633
BspPI GGATC 1 cut(s) 410
BspTNI GGTCTC 1 cut(s) 157
BsrI ACTGG 1 cut(s) 481
BssECI CCNNGG 1 cut(s) 75
BssMI GATC 2 cut(s) 145, 402
BssT1I CCWWGG 1 cut(s) 75
Bst2UI CCWGG 1 cut(s) 426
Bst4CI ACNGT 2 cut(s) 160, 268
BstDEI CTNAG 2 cut(s) 457, 498
BstF5I GGATG 2 cut(s) 343, 376
BstKTI GATC 2 cut(s) 148, 405
BstMAI GTCTC 1 cut(s) 157
BstMBI GATC 2 cut(s) 145, 402
BstMWI GCNNNNNNNGC 8 cut(s) 48, 57, 71, 77, 80, 178, 458, 628
BstNI CCWGG 1 cut(s) 426
BstSCI CCNGG 1 cut(s) 424
BstSFI CTRYAG 1 cut(s) 629
BstV1I GCAGC 7 cut(s) 35, 58, 67, 159, 579, 604, 615
BsuI GTATCC 1 cut(s) 432
BsuRI GGCC 1 cut(s) 97
BtsCI GGATG 2 cut(s) 343, 376
BtsIMutI CAGTG 2 cut(s) 165, 474
Csp6I GTAC 1 cut(s) 13
CviQI GTAC 1 cut(s) 13
DdeI CTNAG 2 cut(s) 457, 498
DpnI GATC 2 cut(s) 147, 404
DpnII GATC 2 cut(s) 145, 402
DraI TTTAAA 1 cut(s) 348
EaeI YGGCCR 1 cut(s) 95
Eco130I CCWWGG 1 cut(s) 75
Eco24I GRGCYC 2 cut(s) 264, 491
Eco31I GGTCTC 1 cut(s) 157
Eco57I CTGAAG 1 cut(s) 608
EcoRII CCWGG 1 cut(s) 424
EcoT14I CCWWGG 1 cut(s) 75
EcoT38I GRGCYC 2 cut(s) 264, 491
ErhI CCWWGG 1 cut(s) 75
FaiI YATR 5 cut(s) 63, 94, 186, 355, 357
FauNDI CATATG 1 cut(s) 355
Fnu4HI GCNGC 7 cut(s) 49, 72, 81, 173, 568, 593, 629
FokI GGATG 2 cut(s) 350, 383
FriOI GRGCYC 2 cut(s) 264, 491
Fsp4HI GCNGC 7 cut(s) 49, 72, 81, 173, 568, 593, 629
FspBI CTAG 1 cut(s) 561
GluI GCNGC 7 cut(s) 49, 72, 81, 173, 568, 593, 629
HaeIII GGCC 1 cut(s) 97
HinfI GANTC 2 cut(s) 119, 304
HphI GGTGA 1 cut(s) 338
Hpy188I TCNGA 1 cut(s) 309
Hpy188III TCNNGA 2 cut(s) 386, 599
Hpy99I CGWCG 1 cut(s) 32
HpyAV CCTTC 4 cut(s) 240, 251, 266, 310
HpyCH4III ACNGT 2 cut(s) 160, 268
HpyCH4V TGCA 6 cut(s) 175, 254, 410, 521, 567, 631
HpyF10VI GCNNNNNNNGC 8 cut(s) 48, 57, 71, 77, 80, 178, 458, 628
HpyF3I CTNAG 2 cut(s) 457, 498
Kzo9I GATC 2 cut(s) 145, 402
LpnPI CCDG 7 cut(s) 180, 352, 371, 411, 438, 462, 552
Lsp1109I GCAGC 7 cut(s) 35, 58, 67, 159, 579, 604, 615
LweI GCATC 2 cut(s) 328, 427
MaeI CTAG 1 cut(s) 561
MaeIII GTNAC 2 cut(s) 207, 472
MalI GATC 2 cut(s) 147, 404
MboI GATC 2 cut(s) 145, 402
MboII GAAGA 2 cut(s) 185, 313
MhlI GDGCHC 2 cut(s) 264, 491
MlsI TGGCCA 1 cut(s) 97
MluCI AATT 3 cut(s) 286, 349, 515
MluNI TGGCCA 1 cut(s) 97
MnlI CCTC 9 cut(s) 49, 76, 124, 198, 216, 322, 372, 466, 493
Mox20I TGGCCA 1 cut(s) 97
MscI TGGCCA 1 cut(s) 97
MseI TTAA 3 cut(s) 236, 347, 444
Msp20I TGGCCA 1 cut(s) 97
MspR9I CCNGG 1 cut(s) 426
MvaI CCWGG 1 cut(s) 426
MwoI GCNNNNNNNGC 8 cut(s) 48, 57, 71, 77, 80, 178, 458, 628
NdeI CATATG 1 cut(s) 355
NdeII GATC 2 cut(s) 145, 402
NmuCI GTSAC 1 cut(s) 472
PfeI GAWTC 2 cut(s) 119, 304
PkrI GCNGC 7 cut(s) 50, 73, 82, 174, 569, 594, 630
Psp6I CCWGG 1 cut(s) 424
PspGI CCWGG 1 cut(s) 424
PstI CTGCAG 1 cut(s) 633
RsaI GTAC 1 cut(s) 14
RsaNI GTAC 1 cut(s) 13
SaqAI TTAA 3 cut(s) 236, 347, 444
SatI GCNGC 7 cut(s) 49, 72, 81, 173, 568, 593, 629
Sau3AI GATC 2 cut(s) 145, 402
ScrFI CCNGG 1 cut(s) 426
SduI GDGCHC 2 cut(s) 264, 491
SetI ASST 9 cut(s) 50, 169, 209, 366, 430, 458, 504, 597, 630
SfaNI GCATC 2 cut(s) 328, 427
SfcI CTRYAG 1 cut(s) 629
Sse9I AATT 3 cut(s) 286, 349, 515
SsiI CCGC 4 cut(s) 51, 154, 181, 536
SspI AATATT 1 cut(s) 549
SspMI CTAG 1 cut(s) 561
StyD4I CCNGG 1 cut(s) 424
StyI CCWWGG 1 cut(s) 75
TaaI ACNGT 2 cut(s) 160, 268
TaqI TCGA 2 cut(s) 27, 144
TasI AATT 3 cut(s) 286, 349, 515
TfiI GAWTC 2 cut(s) 119, 304
Tru1I TTAA 3 cut(s) 236, 347, 444
Tru9I TTAA 3 cut(s) 236, 347, 444
TscAI CASTG 2 cut(s) 165, 481
TseFI GTSAC 1 cut(s) 472
TseI GCWGC 7 cut(s) 48, 71, 80, 172, 567, 592, 628
Tsp45I GTSAC 1 cut(s) 472
TspDTI ATGAA 1 cut(s) 342
TspGWI ACGGA 1 cut(s) 45
TspRI CASTG 2 cut(s) 165, 481
XapI RAATTY 2 cut(s) 349, 515
XspI CTAG 1 cut(s) 561
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.