Rmu_sc0011424.1_g000037

Protein RETICULATA-related

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011424.1
Physical Location & Seq
Reverse (-)
141021 .. 142383
1363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011424.1_g000037.1.cds

Sequence Viewer

Length: 531 bp
atggccattatagctgattttatgcttgtctggcttcctgctcctactgtttcacttcgaaaacctcttgttgtcagtgctgggcgtgttgctaagttcttctatggctgtcctgacaatgcatttcaggtagctttgtctggaacatcttactcagtcttacagagaataggcgcaatcttgagaaatggagcaaaactattcgtggttgggactggtgcatctctgattggtactggtgtaacaaatgcattgattgctgcaagaaaagctttggacaaatcctttcttggtgaagcagaagatgttcccatattatcaactagtgcagcctatggggtctatatggcagtttctagcaatctaaggtaccaagttctcgctggaataatcgaacaacgtattctagaacccttgctacaccaacacaagcttgcactgagtgcaatttgctttgctgttcgaactggaaacacatttttggggtccttgatgtgggttgattatgcacgctggattggaattcaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

176

Amino Acids

18.91

Weight (kDa)

9.59

Isoelectric Point (pI)

27.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 369
AccB1I GGYRCC 1 cut(s) 369
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 522
AdeI CACNNNGTG 1 cut(s) 443
AfaI GTAC 2 cut(s) 235, 371
AfiI CCNNNNNNNGG 1 cut(s) 495
AgsI TTSAA 1 cut(s) 527
AhlI ACTAGT 1 cut(s) 323
AluBI AGCT 4 cut(s) 14, 134, 272, 433
AluI AGCT 4 cut(s) 14, 134, 272, 433
AoxI GGCC 1 cut(s) 3
ApeKI GCWGC 2 cut(s) 260, 329
ApoI RAATTY 1 cut(s) 522
Asp700I GAANNNNTTC 1 cut(s) 306
Asp718I GGTACC 1 cut(s) 369
AspLEI GCGC 1 cut(s) 176
AspS9I GGNCC 1 cut(s) 486
AsuHPI GGTGA 1 cut(s) 305
AsuII TTCGAA 2 cut(s) 58, 463
AvaII GGWCC 1 cut(s) 486
BaeI ACNNNNGTAYC 2 cut(s) 225, 258
BalI TGGCCA 1 cut(s) 5
BanI GGYRCC 1 cut(s) 369
BbvI GCAGC 2 cut(s) 247, 341
BcuI ACTAGT 1 cut(s) 323
BfaI CTAG 3 cut(s) 324, 357, 407
BisI GCNGC 2 cut(s) 261, 330
BlsI GCNGC 2 cut(s) 262, 331
Bme18I GGWCC 1 cut(s) 486
BmgT120I GGNCC 1 cut(s) 486
BmiI GGNNCC 2 cut(s) 371, 487
BmsI GCATC 1 cut(s) 230
Bpu14I TTCGAA 2 cut(s) 58, 463
BpuEI CTTGAG 1 cut(s) 202
Bsc4I CCNNNNNNNGG 1 cut(s) 495
Bse1I ACTGG 3 cut(s) 220, 241, 472
BseLI CCNNNNNNNGG 1 cut(s) 495
BseMII CTCAG 2 cut(s) 168, 431
BseNI ACTGG 3 cut(s) 220, 241, 472
BseXI GCAGC 2 cut(s) 247, 341
BseYI CCCAGC 1 cut(s) 80
BsgI GTGCAG 1 cut(s) 348
BshFI GGCC 1 cut(s) 5
BshNI GGYRCC 1 cut(s) 369
BslFI GGGAC 1 cut(s) 226
BslI CCNNNNNNNGG 1 cut(s) 495
BsmFI GGGAC 1 cut(s) 226
BsnI GGCC 1 cut(s) 5
Bsp119I TTCGAA 2 cut(s) 58, 463
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 2 cut(s) 167, 432
BspLI GGNNCC 2 cut(s) 371, 487
BspT104I TTCGAA 2 cut(s) 58, 463
BspT107I GGYRCC 1 cut(s) 369
BsrI ACTGG 3 cut(s) 220, 241, 472
Bst4CI ACNGT 1 cut(s) 49
BstAPI GCANNNNNTGC 2 cut(s) 257, 443
BstBI TTCGAA 2 cut(s) 58, 463
BstC8I GCNNGC 2 cut(s) 435, 511
BstDEI CTNAG 4 cut(s) 93, 154, 365, 440
BstHHI GCGC 1 cut(s) 176
BstMWI GCNNNNNNNGC 5 cut(s) 11, 31, 257, 269, 443
BstV1I GCAGC 2 cut(s) 247, 341
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 2 cut(s) 82, 437
Cac8I GCNNGC 2 cut(s) 435, 511
CfoI GCGC 1 cut(s) 176
Cfr13I GGNCC 1 cut(s) 486
Csp6I GTAC 2 cut(s) 234, 370
CviJI RGCY 8 cut(s) 5, 14, 34, 108, 134, 272, 332, 433
CviKI_1 RGCY 8 cut(s) 5, 14, 34, 108, 134, 272, 332, 433
CviQI GTAC 2 cut(s) 234, 370
DdeI CTNAG 4 cut(s) 93, 154, 365, 440
DraIII CACNNNGTG 1 cut(s) 443
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 486
EcoO109I RGGNCCY 1 cut(s) 486
EcoRI GAATTC 1 cut(s) 522
EcoT22I ATGCAT 2 cut(s) 124, 253
FaiI YATR 8 cut(s) 11, 23, 105, 314, 336, 345, 347, 507
FalI AAGNNNNNCTT 2 cut(s) 256, 288
FaqI GGGAC 1 cut(s) 226
Fnu4HI GCNGC 2 cut(s) 261, 330
Fsp4HI GCNGC 2 cut(s) 261, 330
FspBI CTAG 3 cut(s) 324, 357, 407
GlaI GCGC 1 cut(s) 175
GluI GCNGC 2 cut(s) 261, 330
GsaI CCCAGC 1 cut(s) 84
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 176
Hin6I GCGC 1 cut(s) 174
HinP1I GCGC 1 cut(s) 174
HindIII AAGCTT 2 cut(s) 270, 431
HphI GGTGA 1 cut(s) 305
Hpy188I TCNGA 1 cut(s) 228
Hpy188III TCNNGA 4 cut(s) 113, 141, 181, 407
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 400
HpyCH4V TGCA 8 cut(s) 122, 221, 251, 263, 329, 437, 446, 509
HpyF10VI GCNNNNNNNGC 5 cut(s) 11, 31, 257, 269, 443
HpyF3I CTNAG 4 cut(s) 93, 154, 365, 440
HpySE526I ACGT 1 cut(s) 400
HspAI GCGC 1 cut(s) 174
KpnI GGTACC 1 cut(s) 373
LmnI GCTCC 2 cut(s) 46, 191
Lsp1109I GCAGC 2 cut(s) 247, 341
LweI GCATC 1 cut(s) 230
MaeI CTAG 3 cut(s) 324, 357, 407
MaeII ACGT 1 cut(s) 400
MaeIII GTNAC 1 cut(s) 241
MboII GAAGA 2 cut(s) 91, 314
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 447, 522
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 75
Mox20I TGGCCA 1 cut(s) 5
Mph1103I ATGCAT 2 cut(s) 124, 253
MroXI GAANNNNTTC 1 cut(s) 306
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 5 cut(s) 11, 31, 257, 269, 443
NlaIV GGNNCC 2 cut(s) 371, 487
NsiI ATGCAT 2 cut(s) 124, 253
NspV TTCGAA 2 cut(s) 58, 463
PdmI GAANNNNTTC 1 cut(s) 306
PkrI GCNGC 2 cut(s) 262, 331
PpuMI RGGWCCY 1 cut(s) 486
Psp5II RGGWCCY 1 cut(s) 486
PspFI CCCAGC 1 cut(s) 80
PspN4I GGNNCC 2 cut(s) 371, 487
PspPI GGNCC 1 cut(s) 486
PspPPI RGGWCCY 1 cut(s) 486
PsrI GAACNNNNNNTAC 2 cut(s) 402, 434
RsaI GTAC 2 cut(s) 235, 371
RsaNI GTAC 2 cut(s) 234, 370
SatI GCNGC 2 cut(s) 261, 330
Sau96I GGNCC 1 cut(s) 486
SetI ASST 8 cut(s) 16, 67, 132, 136, 274, 371, 403, 435
SfaNI GCATC 1 cut(s) 230
SfuI TTCGAA 2 cut(s) 58, 463
SinI GGWCC 1 cut(s) 486
SmlI CTYRAG 1 cut(s) 181
SmoI CTYRAG 1 cut(s) 181
SpeI ACTAGT 1 cut(s) 323
Sse9I AATT 2 cut(s) 447, 522
SspMI CTAG 3 cut(s) 324, 357, 407
TaaI ACNGT 1 cut(s) 49
TaiI ACGT 1 cut(s) 403
TaqI TCGA 3 cut(s) 58, 393, 463
TasI AATT 2 cut(s) 447, 522
TscAI CASTG 2 cut(s) 82, 444
TseI GCWGC 2 cut(s) 260, 329
TspRI CASTG 2 cut(s) 82, 444
VpaK11BI GGWCC 1 cut(s) 486
XapI RAATTY 1 cut(s) 522
XbaI TCTAGA 1 cut(s) 406
XcmI CCANNNNNNNNNTGG 1 cut(s) 380
XmnI GAANNNNTTC 1 cut(s) 306
XspI CTAG 3 cut(s) 324, 357, 407
Zsp2I ATGCAT 2 cut(s) 124, 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.