Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0014026.1

Orthogroup ID

OG0002218

Physical Location & Seq

Genomic Coordinates Reverse (-)

16265 .. 19254

Gene Structure 2990 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0014026.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 564 bp

atgcttgtatatcttcctgccccaactgtttctcttcgaccaccagttgcactcagcgcaggggcaatcaccaagtttttccatggttgccctgataatgcattccagattgctatctcaggaacatcatactccttatttcagaggattggtgcagtagtgagaaatgggagcaagctcttcgttgttggtactgcttcatcactgagaaatgggagcaagctcttcgttgttggtactgcttcatcactggttggcacaagtgttacaaatgccttgatcaatgcaaagaaggctgttggtagctccgcagaggctgaagctgagcatgtacctatagtatccactagccttgcatacggtgtctatatggcagtttctagcaatctcaggtaccaagtattggctggtgttattgaacaaaggatgttggagccactactacatcaacacaagctaatgctaagcgcagtatgctttgccgttcgaactggcaacacattcttgggttcattattgtgggtggactatgctcgtttaatcgggattcagaaggcccattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RETICULATA-like

Protein Analysis

187

Amino Acids

19.81

Weight (kDa)

9.83

Isoelectric Point (pI)

22.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002218)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G12470
fragaria_vesca	FvH4_3g28550 FvH4_3g28550 FvH4_3g28550 FvH4_7g01660 FvH4_7g01660
malus_domestica	MD02G1301900.v1.1 MD03G1172700.v1.1 MD07G1022100.v1.1 MD07G1022200.v1.1 MD11G1190600.v1.1
prunus_persica	Prupe.2G022300_v2.0.a1 Prupe.4G253900_v2.0.a1
pyrus_communis	pycom02g25410 pycom03g12990 pycom07g01680 pycom11g16650
rosa_chinensis	RchiOBHm_Chr1g0317941 RchiOBHm_Chr5g0052771
rosa_laevigata	RLG00000030572 RLG00000034800
rosa_multiflora	Rmu_co8100628.1_g000001 Rmu_co8460597.1_g000001 Rmu_sc0010119.1_g000003 Rmu_sc0011424.1_g000037 Rmu_sc0014026.1_g000003 Rmu_ssc0000008.1_g000032
rosa_roxburghii	Rroxscaffold_1G00028580 Rroxscaffold_4G00330080
rosa_rugosa	Rorug01G0018600 Rorug01G0018700 Rorug05G0270000
rosa_samantha	Rh1AG030400 Rh1BG026800 Rh1CG029100 Rh1DG041100 Rh5AG342000 Rh5BG352600 Rh5CG379300 Rh5DG369000
rosa_wichuraiana	Rw0G017390 Rw1G002300 Rw5G032240

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	393
AccB1I	GGYRCC	1 cut(s)	393
AccB7I	CCANNNNNTGG	1 cut(s)	403
AciI	CCGC	1 cut(s)	309
AcuI	CTGAAG	1 cut(s)	339
AfaI	GTAC	4 cut(s)	193, 238, 333, 395
AfiI	CCNNNNNNNGG	1 cut(s)	403
AgsI	TTSAA	1 cut(s)	419
AluBI	AGCT	5 cut(s)	178, 223, 306, 323, 457
AluI	AGCT	5 cut(s)	178, 223, 306, 323, 457
AlwNI	CAGNNNCTG	1 cut(s)	317
AoxI	GGCC	1 cut(s)	555
Asp718I	GGTACC	1 cut(s)	393
AspLEI	GCGC	2 cut(s)	59, 470
AspS9I	GGNCC	1 cut(s)	556
AsuHPI	GGTGA	1 cut(s)	61
AsuII	TTCGAA	1 cut(s)	487
BanI	GGYRCC	1 cut(s)	393
BceAI	ACGGC	1 cut(s)	467
BcgI	CGANNNNNNTGC	4 cut(s)	163, 197, 208, 242
BciVI	GTATCC	1 cut(s)	352
BclI	TGATCA	1 cut(s)	279
BfaI	CTAG	2 cut(s)	348, 381
BfmI	CTRYAG	1 cut(s)	336
BfuI	GTATCC	1 cut(s)	352
BlpI	GCTNAGC	2 cut(s)	324, 464
BmgT120I	GGNCC	1 cut(s)	556
BmiI	GGNNCC	2 cut(s)	395, 435
Bpu1102I	GCTNAGC	2 cut(s)	324, 464
Bpu14I	TTCGAA	1 cut(s)	487
BsaBI	GATNNNNATC	1 cut(s)	113
BsaJI	CCNNGG	1 cut(s)	82
Bsc4I	CCNNNNNNNGG	1 cut(s)	403
Bse1I	ACTGG	3 cut(s)	44, 255, 496
Bse8I	GATNNNNATC	1 cut(s)	113
BseDI	CCNNGG	1 cut(s)	82
BseGI	GGATG	1 cut(s)	432
BseJI	GATNNNNATC	1 cut(s)	113
BseLI	CCNNNNNNNGG	1 cut(s)	403
BseMII	CTCAG	5 cut(s)	67, 132, 197, 315, 403
BseNI	ACTGG	3 cut(s)	44, 255, 496
BsgI	GTGCAG	1 cut(s)	174
BshFI	GGCC	1 cut(s)	557
BshNI	GGYRCC	1 cut(s)	393
BslI	CCNNNNNNNGG	1 cut(s)	403
BsmI	GAATGC	1 cut(s)	101
BsnI	GGCC	1 cut(s)	557
Bsp119I	TTCGAA	1 cut(s)	487
Bsp143I	GATC	1 cut(s)	279
Bsp1720I	GCTNAGC	2 cut(s)	324, 464
Bsp19I	CCATGG	1 cut(s)	82
BspACI	CCGC	1 cut(s)	309
BspANI	GGCC	1 cut(s)	557
BspCNI	CTCAG	5 cut(s)	66, 131, 198, 316, 402
BspLI	GGNNCC	2 cut(s)	395, 435
BspQI	GCTCTTC	2 cut(s)	185, 230
BspT104I	TTCGAA	1 cut(s)	487
BspT107I	GGYRCC	1 cut(s)	393
BsrI	ACTGG	3 cut(s)	44, 255, 496
BssECI	CCNNGG	1 cut(s)	82
BssMI	GATC	1 cut(s)	279
BssT1I	CCWWGG	1 cut(s)	82
Bst4CI	ACNGT	2 cut(s)	28, 362
Bst6I	CTCTTC	3 cut(s)	39, 185, 230
BstBI	TTCGAA	1 cut(s)	487
BstC8I	GCNNGC	2 cut(s)	176, 221
BstDEI	CTNAG	6 cut(s)	53, 118, 206, 324, 389, 464
BstDSI	CCRYGG	1 cut(s)	82
BstF5I	GGATG	1 cut(s)	432
BstHHI	GCGC	2 cut(s)	59, 470
BstKTI	GATC	1 cut(s)	282
BstMBI	GATC	1 cut(s)	279
BstMWI	GCNNNNNNNGC	3 cut(s)	56, 293, 474
BstNSI	RCATGY	1 cut(s)	332
BstSFI	CTRYAG	1 cut(s)	336
BsuI	GTATCC	1 cut(s)	352
BsuRI	GGCC	1 cut(s)	557
BtgI	CCRYGG	1 cut(s)	82
BtsCI	GGATG	1 cut(s)	432
BtsIMutI	CAGTG	2 cut(s)	203, 248
Cac8I	GCNNGC	2 cut(s)	176, 221
CaiI	CAGNNNCTG	1 cut(s)	317
CfoI	GCGC	2 cut(s)	59, 470
Cfr13I	GGNCC	1 cut(s)	556
Csp6I	GTAC	4 cut(s)	192, 237, 332, 394
CspCI	CAANNNNNGTGG	2 cut(s)	334, 369
CviAII	CATG	2 cut(s)	83, 329
CviQI	GTAC	4 cut(s)	192, 237, 332, 394
DdeI	CTNAG	6 cut(s)	53, 118, 206, 324, 389, 464
DpnI	GATC	1 cut(s)	281
DpnII	GATC	1 cut(s)	279
Eam1104I	CTCTTC	3 cut(s)	39, 185, 230
EarI	CTCTTC	3 cut(s)	39, 185, 230
Eco130I	CCWWGG	1 cut(s)	82
Eco57I	CTGAAG	1 cut(s)	339
EcoT14I	CCWWGG	1 cut(s)	82
EcoT22I	ATGCAT	1 cut(s)	103
ErhI	CCWWGG	1 cut(s)	82
FaeI	CATG	2 cut(s)	86, 332
FatI	CATG	2 cut(s)	82, 328
FbaI	TGATCA	1 cut(s)	279
FokI	GGATG	1 cut(s)	439
FspBI	CTAG	2 cut(s)	348, 381
GlaI	GCGC	2 cut(s)	58, 469
HaeIII	GGCC	1 cut(s)	557
HhaI	GCGC	2 cut(s)	59, 470
Hin1II	CATG	2 cut(s)	86, 332
Hin6I	GCGC	2 cut(s)	57, 468
HinP1I	GCGC	2 cut(s)	57, 468
HinfI	GANTC	1 cut(s)	547
HphI	GGTGA	1 cut(s)	61
Hpy166II	GTNNAC	1 cut(s)	526
Hpy188I	TCNGA	2 cut(s)	144, 552
Hpy188III	TCNNGA	3 cut(s)	106, 120, 544
Hpy8I	GTNNAC	1 cut(s)	526
HpyAV	CCTTC	2 cut(s)	286, 547
HpyCH4III	ACNGT	2 cut(s)	28, 362
HpyCH4V	TGCA	5 cut(s)	50, 101, 155, 287, 356
HpyF10VI	GCNNNNNNNGC	3 cut(s)	56, 293, 474
HpyF3I	CTNAG	6 cut(s)	53, 118, 206, 324, 389, 464
Hsp92II	CATG	2 cut(s)	86, 332
HspAI	GCGC	2 cut(s)	57, 468
KpnI	GGTACC	1 cut(s)	397
Ksp22I	TGATCA	1 cut(s)	279
Kzo9I	GATC	1 cut(s)	279
LguI	GCTCTTC	2 cut(s)	185, 230
LmnI	GCTCC	4 cut(s)	171, 216, 311, 433
MaeI	CTAG	2 cut(s)	348, 381
MaeIII	GTNAC	1 cut(s)	265
MalI	GATC	1 cut(s)	281
MboI	GATC	1 cut(s)	279
MboII	GAAGA	4 cut(s)	5, 26, 172, 217
MmeI	TCCRAC	1 cut(s)	411
MnlI	CCTC	2 cut(s)	138, 307
Mph1103I	ATGCAT	1 cut(s)	103
MseI	TTAA	1 cut(s)	539
MslI	CAYNNNNRTG	1 cut(s)	517
Mva1269I	GAATGC	1 cut(s)	101
MwoI	GCNNNNNNNGC	3 cut(s)	56, 293, 474
NcoI	CCATGG	1 cut(s)	82
NdeII	GATC	1 cut(s)	279
NlaIII	CATG	2 cut(s)	86, 332
NlaIV	GGNNCC	2 cut(s)	395, 435
NsiI	ATGCAT	1 cut(s)	103
NspI	RCATGY	1 cut(s)	332
NspV	TTCGAA	1 cut(s)	487
PciSI	GCTCTTC	2 cut(s)	185, 230
PctI	GAATGC	1 cut(s)	101
PfeI	GAWTC	1 cut(s)	547
PflMI	CCANNNNNTGG	1 cut(s)	403
PspN4I	GGNNCC	2 cut(s)	395, 435
PspPI	GGNCC	1 cut(s)	556
PstNI	CAGNNNCTG	1 cut(s)	317
RsaI	GTAC	4 cut(s)	193, 238, 333, 395
RsaNI	GTAC	4 cut(s)	192, 237, 332, 394
RseI	CAYNNNNRTG	1 cut(s)	517
SapI	GCTCTTC	2 cut(s)	185, 230
SaqAI	TTAA	1 cut(s)	539
Sau3AI	GATC	1 cut(s)	279
Sau96I	GGNCC	1 cut(s)	556
SetI	ASST	7 cut(s)	180, 225, 308, 325, 337, 395, 459
SfcI	CTRYAG	1 cut(s)	336
SfuI	TTCGAA	1 cut(s)	487
SmiMI	CAYNNNNRTG	1 cut(s)	517
SsiI	CCGC	1 cut(s)	309
SspMI	CTAG	2 cut(s)	348, 381
StyI	CCWWGG	1 cut(s)	82
TaaI	ACNGT	2 cut(s)	28, 362
TaqI	TCGA	2 cut(s)	37, 487
TfiI	GAWTC	1 cut(s)	547
Tru1I	TTAA	1 cut(s)	539
Tru9I	TTAA	1 cut(s)	539
TscAI	CASTG	2 cut(s)	210, 255
TspDTI	ATGAA	3 cut(s)	189, 234, 501
TspRI	CASTG	2 cut(s)	210, 255
Van91I	CCANNNNNTGG	1 cut(s)	403
XceI	RCATGY	1 cut(s)	332
XcmI	CCANNNNNNNNNTGG	1 cut(s)	404
XspI	CTAG	2 cut(s)	348, 381
Zsp2I	ATGCAT	1 cut(s)	103

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.