Rmu_sc0034561.1_g000001
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0034561.1
OG0000843
Physical Location & Seq
Reverse (-)
3763 .. 4218
456 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0034561.1_g000001.1.cds

Sequence Viewer

Length: 360 bp
atgggagtggccgttacaccaaaccttcacgttgctgctataactaccagtgcattttattcagtatggaatcttttttccggcttcttaatcccacgaactaggattcctatatggtggagatggtactattggggatgtccagtggcttggagcttgtatggattggctacatcacagtttggagattcacagaacaaccttgagacgggagaaactgtagaagaatttatgaggagctactttggtttcaaacatgaatttctaggagtggttgcagctgtggttgttggatttgcagtactctttgcatttatctttgccttggcaatcaagatgttgaacttccagaggagatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

119

Amino Acids

13.62

Weight (kDa)

8.93

Isoelectric Point (pI)

30.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 9
AcsI RAATTY 2 cut(s) 227, 260
AfaI GTAC 2 cut(s) 128, 303
AfiI CCNNNNNNNGG 1 cut(s) 208
AgsI TTSAA 2 cut(s) 253, 343
AloI GAACNNNNNNTCC 2 cut(s) 91, 123
AluBI AGCT 3 cut(s) 156, 240, 281
AluI AGCT 3 cut(s) 156, 240, 281
Alw26I GTCTC 1 cut(s) 200
AoxI GGCC 1 cut(s) 9
ApeKI GCWGC 2 cut(s) 35, 278
ApoI RAATTY 2 cut(s) 227, 260
BbvI GCAGC 2 cut(s) 22, 290
BccI CCATC 1 cut(s) 117
BcoDI GTCTC 1 cut(s) 200
BfaI CTAG 2 cut(s) 102, 266
BfmI CTRYAG 1 cut(s) 219
BisI GCNGC 2 cut(s) 36, 279
BlsI GCNGC 2 cut(s) 37, 280
BmcAI AGTACT 1 cut(s) 303
BpuEI CTTGAG 1 cut(s) 224
BsaJI CCNNGG 1 cut(s) 324
BsaXI ACNNNNNCTCC 3 cut(s) 27, 204, 234
Bsc4I CCNNNNNNNGG 1 cut(s) 208
Bse1I ACTGG 2 cut(s) 48, 143
BseDI CCNNGG 1 cut(s) 324
BseGI GGATG 1 cut(s) 143
BseLI CCNNNNNNNGG 1 cut(s) 208
BseNI ACTGG 2 cut(s) 48, 143
BseRI GAGGAG 1 cut(s) 250
BseXI GCAGC 2 cut(s) 22, 290
BshFI GGCC 1 cut(s) 11
BsiSI CCGG 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 208
BsmAI GTCTC 1 cut(s) 200
BsmBI CGTCTC 1 cut(s) 200
BsnI GGCC 1 cut(s) 11
BspANI GGCC 1 cut(s) 11
BsrI ACTGG 2 cut(s) 48, 143
BssECI CCNNGG 1 cut(s) 324
BssT1I CCWWGG 1 cut(s) 324
Bst4CI ACNGT 2 cut(s) 180, 220
BstF5I GGATG 1 cut(s) 143
BstMAI GTCTC 1 cut(s) 200
BstSFI CTRYAG 1 cut(s) 219
BstV1I GCAGC 2 cut(s) 22, 290
BstXI CCANNNNNNTGG 1 cut(s) 150
BsuRI GGCC 1 cut(s) 11
BtsCI GGATG 1 cut(s) 143
BtsIMutI CAGTG 2 cut(s) 55, 150
Csp6I GTAC 2 cut(s) 127, 302
CviAII CATG 1 cut(s) 257
CviJI RGCY 7 cut(s) 11, 84, 149, 156, 170, 240, 281
CviKI_1 RGCY 7 cut(s) 11, 84, 149, 156, 170, 240, 281
CviQI GTAC 2 cut(s) 127, 302
EaeI YGGCCR 1 cut(s) 9
Eco130I CCWWGG 1 cut(s) 324
EcoT14I CCWWGG 1 cut(s) 324
ErhI CCWWGG 1 cut(s) 324
Esp3I CGTCTC 1 cut(s) 200
FaeI CATG 1 cut(s) 260
FaiI YATR 7 cut(s) 41, 67, 113, 115, 162, 233, 258
FatI CATG 1 cut(s) 256
Fnu4HI GCNGC 2 cut(s) 36, 279
FokI GGATG 1 cut(s) 150
Fsp4HI GCNGC 2 cut(s) 36, 279
FspBI CTAG 2 cut(s) 102, 266
GluI GCNGC 2 cut(s) 36, 279
HaeIII GGCC 1 cut(s) 11
HapII CCGG 1 cut(s) 81
Hin1II CATG 1 cut(s) 260
HinfI GANTC 3 cut(s) 70, 106, 188
HpaII CCGG 1 cut(s) 81
Hpy188III TCNNGA 2 cut(s) 334, 349
HpyAV CCTTC 1 cut(s) 35
HpyCH4III ACNGT 2 cut(s) 180, 220
HpyCH4IV ACGT 1 cut(s) 30
HpyCH4V TGCA 4 cut(s) 53, 278, 299, 311
HpySE526I ACGT 1 cut(s) 30
Hsp92II CATG 1 cut(s) 260
LmnI GCTCC 2 cut(s) 153, 237
LpnPI CCDG 3 cut(s) 61, 94, 156
Lsp1109I GCAGC 2 cut(s) 22, 290
MaeI CTAG 2 cut(s) 102, 266
MaeII ACGT 1 cut(s) 30
MaeIII GTNAC 1 cut(s) 13
MboII GAAGA 1 cut(s) 236
MluCI AATT 2 cut(s) 227, 260
MmeI TCCRAC 1 cut(s) 271
MnlI CCTC 2 cut(s) 228, 345
MseI TTAA 1 cut(s) 89
MspA1I CMGCKG 1 cut(s) 281
MspI CCGG 1 cut(s) 81
NlaIII CATG 1 cut(s) 260
PfeI GAWTC 3 cut(s) 70, 106, 188
PkrI GCNGC 2 cut(s) 37, 280
PvuII CAGCTG 1 cut(s) 281
RsaI GTAC 2 cut(s) 128, 303
RsaNI GTAC 2 cut(s) 127, 302
SaqAI TTAA 1 cut(s) 89
SatI GCNGC 2 cut(s) 36, 279
ScaI AGTACT 1 cut(s) 303
SetI ASST 6 cut(s) 27, 33, 158, 204, 242, 283
SfcI CTRYAG 1 cut(s) 219
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 2 cut(s) 227, 260
SspMI CTAG 2 cut(s) 102, 266
StyI CCWWGG 1 cut(s) 324
TaaI ACNGT 2 cut(s) 180, 220
TaiI ACGT 1 cut(s) 33
TasI AATT 2 cut(s) 227, 260
TatI WGTACW 1 cut(s) 301
TfiI GAWTC 3 cut(s) 70, 106, 188
Tru1I TTAA 1 cut(s) 89
Tru9I TTAA 1 cut(s) 89
TscAI CASTG 2 cut(s) 55, 150
TseI GCWGC 2 cut(s) 35, 278
TspDTI ATGAA 1 cut(s) 273
TspRI CASTG 2 cut(s) 55, 150
XapI RAATTY 2 cut(s) 227, 260
XspI CTAG 2 cut(s) 102, 266
ZrmI AGTACT 1 cut(s) 303
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.