Rorug03G0286900
ERF Family

Belongs to the ABC transporter superfamily. ABCG family. PDR (TC 3.A.1.205) subfamily

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Forward (+)
29078916 .. 29079098
183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0286900.1

Sequence Viewer

Length: 183 bp
ATGGATGAGTTTAGTGCACTAGGGCCAGATGGGTACAACGGTTGTTTCTTTAAAAAGTGTTGGAGTGTTGTAGCATCTGATGTAGTTTCTGCAGACCAAAGCGTTTTCACTACTGGCTTCATTCTTCCGCATTTTAACTCAAATGTGATAATCTTGATACCAAAGAAACCGGAAGCAGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

60

Amino Acids

6.55

Weight (kDa)

4.7

Isoelectric Point (pI)

18.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 128
AfaI GTAC 1 cut(s) 35
Alw21I GWGCWC 1 cut(s) 19
Alw44I GTGCAC 1 cut(s) 15
AoxI GGCC 1 cut(s) 23
ApaLI GTGCAC 1 cut(s) 15
AspS9I GGNCC 1 cut(s) 23
BaeGI GKGCMC 1 cut(s) 19
BaeI ACNNNNGTAYC 2 cut(s) 25, 58
Bbv12I GWGCWC 1 cut(s) 19
BccI CCATC 1 cut(s) 23
BfaI CTAG 1 cut(s) 20
BfmI CTRYAG 1 cut(s) 90
BmgT120I GGNCC 1 cut(s) 23
BmsI GCATC 1 cut(s) 83
BsaWI WCCGGW 1 cut(s) 169
Bse1I ACTGG 1 cut(s) 118
BseGI GGATG 1 cut(s) 10
BseNI ACTGG 1 cut(s) 118
BseSI GKGCMC 1 cut(s) 19
BshFI GGCC 1 cut(s) 25
BsiHKAI GWGCWC 1 cut(s) 19
BsiSI CCGG 1 cut(s) 170
BsnI GGCC 1 cut(s) 25
Bsp1286I GDGCHC 1 cut(s) 19
BspACI CCGC 1 cut(s) 128
BspANI GGCC 1 cut(s) 25
BspMAI CTGCAG 1 cut(s) 94
BsrI ACTGG 1 cut(s) 118
Bst4CI ACNGT 1 cut(s) 41
BstF5I GGATG 1 cut(s) 10
BstSFI CTRYAG 1 cut(s) 90
BstSLI GKGCMC 1 cut(s) 19
BsuRI GGCC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 23
Csp6I GTAC 1 cut(s) 34
CviJI RGCY 2 cut(s) 25, 117
CviKI_1 RGCY 2 cut(s) 25, 117
CviQI GTAC 1 cut(s) 34
DraI TTTAAA 1 cut(s) 52
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 20
HaeIII GGCC 1 cut(s) 25
HapII CCGG 1 cut(s) 170
HpaII CCGG 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 17
Hpy188I TCNGA 1 cut(s) 79
Hpy188III TCNNGA 1 cut(s) 154
Hpy8I GTNNAC 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 41
HpyCH4V TGCA 2 cut(s) 17, 92
LpnPI CCDG 2 cut(s) 39, 99
LweI GCATC 1 cut(s) 83
MaeI CTAG 1 cut(s) 20
MboII GAAGA 1 cut(s) 116
MhlI GDGCHC 1 cut(s) 19
MmeI TCCRAC 1 cut(s) 41
MseI TTAA 2 cut(s) 51, 135
MspI CCGG 1 cut(s) 170
PspPI GGNCC 1 cut(s) 23
PstI CTGCAG 1 cut(s) 94
RsaI GTAC 1 cut(s) 35
RsaNI GTAC 1 cut(s) 34
SaqAI TTAA 2 cut(s) 51, 135
Sau96I GGNCC 1 cut(s) 23
SduI GDGCHC 1 cut(s) 19
SfaNI GCATC 1 cut(s) 83
SfcI CTRYAG 1 cut(s) 90
SgeI CNNG 4 cut(s) 32, 38, 126, 166
SsiI CCGC 1 cut(s) 128
SspMI CTAG 1 cut(s) 20
TaaI ACNGT 1 cut(s) 41
Tru1I TTAA 2 cut(s) 51, 135
Tru9I TTAA 2 cut(s) 51, 135
TspDTI ATGAA 1 cut(s) 109
VneI GTGCAC 1 cut(s) 15
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.