Rroxscaffold_5G00359530

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0000958
Physical Location & Seq
Reverse (-)
39688808 .. 39689648
841 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00359530.1

Sequence Viewer

Length: 249 bp
ATGAAACCCATATACTTCTTCAATAAAGCAACTCATTACCGCCACCTACCCCTCGTTCACACTGCGTGTGGTAGTGTACAGTCTCCACAAGCACGGGTCCCACATCAAAATGTGTACAGTCTCCTCAAACCAGTGTACTCAGCAAAGAAAACCAAACTGATCACACCATCTCTACTCTCAGCTAAGAAAACCAAACCAGCTCTACCTCAAATGAATAGCTCCAATTACCAGCTCTTAGACTCCAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.24

Weight (kDa)

10.13

Isoelectric Point (pI)

50.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 40
AdeI CACNNNGTG 1 cut(s) 66
AfaI GTAC 3 cut(s) 78, 116, 137
AgsI TTSAA 1 cut(s) 22
AluBI AGCT 4 cut(s) 182, 200, 219, 232
AluI AGCT 4 cut(s) 182, 200, 219, 232
Alw26I GTCTC 2 cut(s) 87, 125
AspS9I GGNCC 1 cut(s) 97
AvaII GGWCC 1 cut(s) 97
BccI CCATC 1 cut(s) 175
BclI TGATCA 1 cut(s) 159
BcoDI GTCTC 2 cut(s) 87, 125
BfaI CTAG 1 cut(s) 247
Bme18I GGWCC 1 cut(s) 97
BmgT120I GGNCC 1 cut(s) 97
BmiI GGNNCC 2 cut(s) 98, 99
Bse1I ACTGG 1 cut(s) 131
BseMII CTCAG 2 cut(s) 153, 192
BseNI ACTGG 1 cut(s) 131
BseRI GAGGAG 1 cut(s) 113
BslFI GGGAC 1 cut(s) 83
BsmAI GTCTC 2 cut(s) 87, 125
BsmFI GGGAC 1 cut(s) 83
Bsp1407I TGTACA 2 cut(s) 76, 114
Bsp143I GATC 1 cut(s) 159
BspACI CCGC 1 cut(s) 40
BspCNI CTCAG 2 cut(s) 152, 191
BspLI GGNNCC 2 cut(s) 98, 99
BsrGI TGTACA 2 cut(s) 76, 114
BsrI ACTGG 1 cut(s) 131
BssMI GATC 1 cut(s) 159
Bst4CI ACNGT 2 cut(s) 81, 119
BstAUI TGTACA 2 cut(s) 76, 114
BstDEI CTNAG 4 cut(s) 139, 178, 183, 235
BstKTI GATC 1 cut(s) 162
BstMAI GTCTC 2 cut(s) 87, 125
BstMBI GATC 1 cut(s) 159
BtsI GCAGTG 1 cut(s) 60
BtsIMutI CAGTG 2 cut(s) 60, 138
Cfr13I GGNCC 1 cut(s) 97
Csp6I GTAC 3 cut(s) 77, 115, 136
CviJI RGCY 4 cut(s) 182, 200, 219, 232
CviKI_1 RGCY 4 cut(s) 182, 200, 219, 232
CviQI GTAC 3 cut(s) 77, 115, 136
DdeI CTNAG 4 cut(s) 139, 178, 183, 235
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
DraIII CACNNNGTG 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 97
EcoO109I RGGNCCY 1 cut(s) 97
FaiI YATR 2 cut(s) 11, 13
FaqI GGGAC 1 cut(s) 83
FbaI TGATCA 1 cut(s) 159
FspBI CTAG 1 cut(s) 247
HinfI GANTC 1 cut(s) 239
Hpy166II GTNNAC 4 cut(s) 58, 77, 115, 136
Hpy8I GTNNAC 4 cut(s) 58, 77, 115, 136
HpyCH4III ACNGT 2 cut(s) 81, 119
HpyF3I CTNAG 4 cut(s) 139, 178, 183, 235
KflI GGGWCCC 1 cut(s) 97
Ksp22I TGATCA 1 cut(s) 159
Kzo9I GATC 1 cut(s) 159
LmnI GCTCC 1 cut(s) 224
LpnPI CCDG 3 cut(s) 144, 210, 242
MaeI CTAG 1 cut(s) 247
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 1 cut(s) 10
MluCI AATT 1 cut(s) 223
MlyI GAGTC 1 cut(s) 233
MnlI CCTC 3 cut(s) 62, 134, 216
MslI CAYNNNNRTG 1 cut(s) 108
NdeII GATC 1 cut(s) 159
NlaIV GGNNCC 2 cut(s) 98, 99
PleI GAGTC 1 cut(s) 233
PpsI GAGTC 1 cut(s) 233
PpuMI RGGWCCY 1 cut(s) 97
Psp5II RGGWCCY 1 cut(s) 97
PspN4I GGNNCC 2 cut(s) 98, 99
PspPI GGNCC 1 cut(s) 97
PspPPI RGGWCCY 1 cut(s) 97
RsaI GTAC 3 cut(s) 78, 116, 137
RsaNI GTAC 3 cut(s) 77, 115, 136
RseI CAYNNNNRTG 1 cut(s) 108
Sau3AI GATC 1 cut(s) 159
Sau96I GGNCC 1 cut(s) 97
SchI GAGTC 1 cut(s) 233
SetI ASST 6 cut(s) 48, 184, 202, 208, 221, 234
SgeI CNNG 8 cut(s) 65, 78, 101, 105, 107, 143, 209, 241
SinI GGWCC 1 cut(s) 97
SmiMI CAYNNNNRTG 1 cut(s) 108
Sse9I AATT 1 cut(s) 223
SsiI CCGC 1 cut(s) 40
SspMI CTAG 1 cut(s) 247
TaaI ACNGT 2 cut(s) 81, 119
TasI AATT 1 cut(s) 223
TatI WGTACW 3 cut(s) 76, 114, 135
TscAI CASTG 2 cut(s) 67, 138
TspDTI ATGAA 2 cut(s) 17, 227
TspRI CASTG 2 cut(s) 67, 138
VpaK11BI GGWCC 1 cut(s) 97
XspI CTAG 1 cut(s) 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.