Rorug02G0551300

EamA-like transporter family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0000534
Physical Location & Seq
Forward (+)
67856166 .. 67856865
700 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0551300.1

Sequence Viewer

Length: 357 bp
ATGGCTGCCCCAGTTGTCCCCAGTTTGATTGTCAATGAACTTCTTAACAAAAACAACTACGAAGCTTGGAATTTTCGGGTCGAAACCTATTTAAGAGCTAAAGGTCTTTGGGGTATTGTAGAAGACGAGGCTGAGCCTCATCTTAAAGGCAAAGATAAACGTGAGGCTTGGGACAAGATCAACGCTGAAGCTCTGCATGCAATTCATATTTGTTGCGGAAATGAGGCCTTTTCAGCTATCAATGGCGAAACGTCAGCCAATAAAGCCTGGAAGACTTTGGCTGATTACCCAGATAGATGGATGAAAAATGAAGCCATGCTTTATATTCTCTGCTACAATACATACAGGCATGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
EamA

Protein Analysis

118

Amino Acids

13.58

Weight (kDa)

6.07

Isoelectric Point (pI)

31.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4219 PF13961 15 - 41 2.6e-08 Domain of unknown function (DUF4219)
Retrotran_gag_2 PF14223 28 - 104 3e-09 gag-polypeptide of LTR copia-type
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000534)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g50400 FvH4_6g50410 FvH4_6g50410 FvH4_6g50410 FvH4_6g50410 FvH4_6g50420 FvH4_6g50420 FvH4_6g50420 FvH4_6g50420 FvH4_6g50420 FvH4_6g50420 FvH4_6g50420 FvH4_6g50420 FvH4_6g50420 FvH4_6g50420 FvH4_6g50420
malus_domestica MD09G1036400.v1.1 MD09G1036600.v1.1 MD17G1038100.v1.1 MD17G1038200.v1.1
prunus_persica Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G280900_v2.0.a1 Prupe.3G281000_v2.0.a1 Prupe.3G281000_v2.0.a1 Prupe.3G281000_v2.0.a1 Prupe.3G281000_v2.0.a1
pyrus_communis pycom111g02920 pycom111g02930 pycom111g02940 pycom111g02950 pycom16g07600 pycom17g03430 pycom17g03440
rosa_chinensis RchiOBHm_Chr2g0170801 RchiOBHm_Chr2g0170811 RchiOBHm_Chr2g0170821 RchiOBHm_Chr2g0170831 RchiOBHm_Chr2g0170841
rosa_laevigata RLG00000021981 RLG00000021983 RLG00000021984 RLG00000021985
rosa_multiflora Rmu_co8418849.1_g000001 Rmu_co8437261.1_g000001 Rmu_sc0008393.1_g000003
rosa_roxburghii Rroxscaffold_1G00030380 Rroxscaffold_2G00081040 Rroxscaffold_2G00081050 Rroxscaffold_2G00081060
rosa_rugosa Rorug02G0551300 Rorug02G0551400 Rorug02G0551700 Rorug02G0551800
rosa_samantha Rh2AG624300 Rh2BG634700 Rh2BG634800 Rh2BG634900 Rh2BG635000 Rh2CG603500 Rh2CG603600 Rh2CG603700 Rh2CG603800
rosa_wichuraiana Rw0G017070 Rw2G051700 Rw2G051710 Rw2G051720

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 216
AcsI RAATTY 1 cut(s) 70
AcuI CTGAAG 1 cut(s) 207
AjnI CCWGG 1 cut(s) 266
AluBI AGCT 4 cut(s) 65, 98, 191, 236
AluI AGCT 4 cut(s) 65, 98, 191, 236
AoxI GGCC 1 cut(s) 225
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 1 cut(s) 70
BbsI GAAGAC 2 cut(s) 129, 278
BccI CCATC 1 cut(s) 291
BciT130I CCWGG 1 cut(s) 268
BisI GCNGC 1 cut(s) 6
BlpI GCTNAGC 1 cut(s) 132
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 268
BmrFI CCNGG 1 cut(s) 268
BmrI ACTGGG 2 cut(s) 5, 15
BmuI ACTGGG 2 cut(s) 5, 15
BpiI GAAGAC 2 cut(s) 129, 278
Bpu1102I GCTNAGC 1 cut(s) 132
Bse1I ACTGG 2 cut(s) 11, 21
BseBI CCWGG 1 cut(s) 268
BseGI GGATG 1 cut(s) 306
BseMII CTCAG 1 cut(s) 123
BseNI ACTGG 2 cut(s) 11, 21
BshFI GGCC 1 cut(s) 227
BslFI GGGAC 2 cut(s) 2, 185
BsmFI GGGAC 2 cut(s) 2, 185
BsnI GGCC 1 cut(s) 227
Bsp143I GATC 1 cut(s) 177
Bsp1720I GCTNAGC 1 cut(s) 132
BspACI CCGC 1 cut(s) 216
BspANI GGCC 1 cut(s) 227
BspCNI CTCAG 1 cut(s) 124
BsrI ACTGG 2 cut(s) 11, 21
BssMI GATC 1 cut(s) 177
Bst2UI CCWGG 1 cut(s) 268
BstC8I GCNNGC 1 cut(s) 198
BstDEI CTNAG 1 cut(s) 132
BstF5I GGATG 1 cut(s) 306
BstKTI GATC 1 cut(s) 180
BstMBI GATC 1 cut(s) 177
BstMWI GCNNNNNNNGC 3 cut(s) 197, 233, 263
BstNI CCWGG 1 cut(s) 268
BstNSI RCATGY 2 cut(s) 200, 353
BstSCI CCNGG 1 cut(s) 266
BstV2I GAAGAC 2 cut(s) 129, 278
BstXI CCANNNNNNTGG 1 cut(s) 297
BsuRI GGCC 1 cut(s) 227
BtsCI GGATG 1 cut(s) 306
Cac8I GCNNGC 1 cut(s) 198
CviAII CATG 3 cut(s) 197, 316, 350
DdeI CTNAG 1 cut(s) 132
DpnI GATC 1 cut(s) 179
DpnII GATC 1 cut(s) 177
Eco147I AGGCCT 1 cut(s) 227
Eco57I CTGAAG 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 266
FaeI CATG 3 cut(s) 200, 319, 353
FaiI YATR 7 cut(s) 198, 207, 317, 324, 343, 351, 355
FalI AAGNNNNNCTT 2 cut(s) 303, 335
FaqI GGGAC 2 cut(s) 2, 185
FatI CATG 3 cut(s) 196, 315, 349
Fnu4HI GCNGC 1 cut(s) 6
FokI GGATG 1 cut(s) 313
Fsp4HI GCNGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 227
Hin1II CATG 3 cut(s) 200, 319, 353
HindIII AAGCTT 1 cut(s) 63
HpyCH4IV ACGT 2 cut(s) 160, 251
HpyCH4V TGCA 2 cut(s) 196, 200
HpyF10VI GCNNNNNNNGC 3 cut(s) 197, 233, 263
HpyF3I CTNAG 1 cut(s) 132
HpySE526I ACGT 2 cut(s) 160, 251
Hsp92II CATG 3 cut(s) 200, 319, 353
Kzo9I GATC 1 cut(s) 177
LpnPI CCDG 6 cut(s) 24, 34, 253, 280, 303, 331
MaeII ACGT 2 cut(s) 160, 251
MalI GATC 1 cut(s) 179
MboI GATC 1 cut(s) 177
MboII GAAGA 2 cut(s) 134, 283
MluCI AATT 2 cut(s) 70, 201
MnlI CCTC 4 cut(s) 121, 147, 157, 217
MseI TTAA 3 cut(s) 45, 92, 144
MspR9I CCNGG 1 cut(s) 268
MvaI CCWGG 1 cut(s) 268
MwoI GCNNNNNNNGC 3 cut(s) 197, 233, 263
NdeII GATC 1 cut(s) 177
NlaIII CATG 3 cut(s) 200, 319, 353
NspI RCATGY 2 cut(s) 200, 353
PaeI GCATGC 1 cut(s) 200
PceI AGGCCT 1 cut(s) 227
PkrI GCNGC 1 cut(s) 7
Psp6I CCWGG 1 cut(s) 266
PspGI CCWGG 1 cut(s) 266
SaqAI TTAA 3 cut(s) 45, 92, 144
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 1 cut(s) 177
ScrFI CCNGG 1 cut(s) 268
SetI ASST 8 cut(s) 67, 89, 100, 106, 163, 193, 238, 254
SphI GCATGC 1 cut(s) 200
Sse9I AATT 2 cut(s) 70, 201
SseBI AGGCCT 1 cut(s) 227
SsiI CCGC 1 cut(s) 216
StuI AGGCCT 1 cut(s) 227
StyD4I CCNGG 1 cut(s) 266
TaiI ACGT 2 cut(s) 163, 254
TaqI TCGA 1 cut(s) 81
TasI AATT 2 cut(s) 70, 201
Tru1I TTAA 3 cut(s) 45, 92, 144
Tru9I TTAA 3 cut(s) 45, 92, 144
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 4 cut(s) 51, 194, 317, 324
XapI RAATTY 1 cut(s) 70
XceI RCATGY 2 cut(s) 200, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.