Rorug03G0339900

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
40506893 .. 40507201
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0339900.1

Sequence Viewer

Length: 309 bp
ATGTCTAATACTAATTGGCTTCCTAATGAAGAAGCTCAATTGTGTAGGTCATGGGTACGTTTTACTACATGCTCCATCACGGGCAATCATCAATCAAAGAACAAGTTATGGGAAAAAATTTATGCCGACTTCACGGAAAATTGGCAAGGAAATCCCCTCTATCCTCGAAGCCAACAAGGTCTACAATCCCATTGGCGCAATTTGAAGGCGGTACTTAAAGTTTGGCATGAATGTTTGCAAAAAGTTGCACACAACCAACGAAGTGGTGAGAATCAAATGGATGAGGTAATATGTTTTCGTCAAATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

12.16

Weight (kDa)

8.8

Isoelectric Point (pI)

57.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 181
AciI CCGC 1 cut(s) 209
AcsI RAATTY 1 cut(s) 117
AfaI GTAC 2 cut(s) 57, 213
AgsI TTSAA 1 cut(s) 205
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
ApoI RAATTY 1 cut(s) 117
AspLEI GCGC 1 cut(s) 198
AsuHPI GGTGA 1 cut(s) 278
BccI CCATC 1 cut(s) 83
BseGI GGATG 1 cut(s) 286
BspACI CCGC 1 cut(s) 209
BstF5I GGATG 1 cut(s) 286
BstHHI GCGC 1 cut(s) 198
BstNSI RCATGY 1 cut(s) 72
BstXI CCANNNNNNTGG 1 cut(s) 263
BtsCI GGATG 1 cut(s) 286
CfoI GCGC 1 cut(s) 198
Csp6I GTAC 2 cut(s) 56, 212
CviAII CATG 3 cut(s) 51, 69, 227
CviJI RGCY 3 cut(s) 19, 35, 171
CviKI_1 RGCY 3 cut(s) 19, 35, 171
CviQI GTAC 2 cut(s) 56, 212
FaeI CATG 3 cut(s) 54, 72, 230
FaiI YATR 7 cut(s) 52, 70, 109, 123, 228, 292, 307
FatI CATG 3 cut(s) 50, 68, 226
FblI GTMKAC 1 cut(s) 181
FokI GGATG 1 cut(s) 293
GlaI GCGC 1 cut(s) 197
HhaI GCGC 1 cut(s) 198
Hin1II CATG 3 cut(s) 54, 72, 230
Hin6I GCGC 1 cut(s) 196
HinP1I GCGC 1 cut(s) 196
HinfI GANTC 1 cut(s) 271
HphI GGTGA 1 cut(s) 278
Hpy166II GTNNAC 1 cut(s) 182
Hpy8I GTNNAC 1 cut(s) 182
HpyAV CCTTC 1 cut(s) 199
HpyCH4IV ACGT 1 cut(s) 58
HpyCH4V TGCA 2 cut(s) 238, 248
HpySE526I ACGT 1 cut(s) 58
Hsp92II CATG 3 cut(s) 54, 72, 230
HspAI GCGC 1 cut(s) 196
LmnI GCTCC 1 cut(s) 77
MaeII ACGT 1 cut(s) 58
MboII GAAGA 1 cut(s) 41
MfeI CAATTG 1 cut(s) 38
MluCI AATT 5 cut(s) 13, 38, 117, 139, 199
MnlI CCTC 3 cut(s) 167, 174, 277
MseI TTAA 1 cut(s) 216
MunI CAATTG 1 cut(s) 38
NlaIII CATG 3 cut(s) 54, 72, 230
NspI RCATGY 1 cut(s) 72
PfeI GAWTC 1 cut(s) 271
RsaI GTAC 2 cut(s) 57, 213
RsaNI GTAC 2 cut(s) 56, 212
SaqAI TTAA 1 cut(s) 216
SetI ASST 5 cut(s) 37, 50, 61, 181, 288
Sse9I AATT 5 cut(s) 13, 38, 117, 139, 199
SsiI CCGC 1 cut(s) 209
TaiI ACGT 1 cut(s) 61
TaqI TCGA 1 cut(s) 166
TasI AATT 5 cut(s) 13, 38, 117, 139, 199
TfiI GAWTC 1 cut(s) 271
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TspDTI ATGAA 2 cut(s) 42, 243
TspGWI ACGGA 1 cut(s) 149
XapI RAATTY 1 cut(s) 117
XceI RCATGY 1 cut(s) 72
XmiI GTMKAC 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.