Rh2AG399100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0001084
Physical Location & Seq
Reverse (-)
59532679 .. 59533195
517 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG399100.1

Sequence Viewer

Length: 258 bp
ATGAGCGACCCGAGCAGAAGAACGACCGACCGACAGAACTGGGTCTGGGTCTCCTCCGAGCAGAAGAGGAACGTCGGTCTGAAGACTGGGCGTCTGGGTCTCCTCCGAGTAGAAGAGGAACGTCGATCTGAAGTACGAACTGGGTCTGGCGTTTGGGTCTTCTCCGAGCAGAAGAGGAACGTCAGTCTGAAGTCCGAACTGGGTCTGGCGTCTGGGTGTCTGGGTCTCCTCCGAGCAGAAGAGGAACGACTGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

85

Amino Acids

9.73

Weight (kDa)

10.14

Isoelectric Point (pI)

77.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 3 cut(s) 101, 150, 209
AcyI GRCGYC 2 cut(s) 91, 209
AfaI GTAC 1 cut(s) 135
AhdI GACNNNNNGTC 1 cut(s) 90
Alw26I GTCTC 3 cut(s) 55, 104, 230
Ama87I CYCGRG 1 cut(s) 10
AvaI CYCGRG 1 cut(s) 10
BbsI GAAGAC 2 cut(s) 89, 151
BcoDI GTCTC 3 cut(s) 55, 104, 230
BmeRI GACNNNNNGTC 1 cut(s) 90
BmeT110I CYCGRG 1 cut(s) 10
BmrI ACTGGG 4 cut(s) 49, 96, 150, 209
BmuI ACTGGG 4 cut(s) 49, 96, 150, 209
BpiI GAAGAC 2 cut(s) 89, 151
BsaHI GRCGYC 2 cut(s) 91, 209
BsaI GGTCTC 3 cut(s) 55, 104, 230
Bse1I ACTGG 4 cut(s) 44, 91, 145, 204
BseNI ACTGG 4 cut(s) 44, 91, 145, 204
BseRI GAGGAG 3 cut(s) 43, 92, 218
Bsh1285I CGRYCG 2 cut(s) 27, 31
BsiEI CGRYCG 2 cut(s) 27, 31
BsiHKCI CYCGRG 1 cut(s) 10
BsmAI GTCTC 3 cut(s) 55, 104, 230
Bso31I GGTCTC 3 cut(s) 55, 104, 230
BsoBI CYCGRG 1 cut(s) 10
Bsp143I GATC 1 cut(s) 125
BspTNI GGTCTC 3 cut(s) 55, 104, 230
BsrI ACTGG 4 cut(s) 44, 91, 145, 204
BssMI GATC 1 cut(s) 125
BssNI GRCGYC 2 cut(s) 91, 209
Bst6I CTCTTC 4 cut(s) 59, 108, 167, 234
BstACI GRCGYC 2 cut(s) 91, 209
BstKTI GATC 1 cut(s) 128
BstMAI GTCTC 3 cut(s) 55, 104, 230
BstMBI GATC 1 cut(s) 125
BstMCI CGRYCG 2 cut(s) 27, 31
BstMWI GCNNNNNNNGC 1 cut(s) 12
BstV2I GAAGAC 2 cut(s) 89, 151
CseI GACGC 2 cut(s) 80, 198
Csp6I GTAC 1 cut(s) 134
CviQI GTAC 1 cut(s) 134
DpnI GATC 1 cut(s) 127
DpnII GATC 1 cut(s) 125
DriI GACNNNNNGTC 1 cut(s) 90
Eam1104I CTCTTC 4 cut(s) 59, 108, 167, 234
Eam1105I GACNNNNNGTC 1 cut(s) 90
EarI CTCTTC 4 cut(s) 59, 108, 167, 234
Eco31I GGTCTC 3 cut(s) 55, 104, 230
Eco57I CTGAAG 3 cut(s) 101, 150, 209
Eco88I CYCGRG 1 cut(s) 10
HgaI GACGC 2 cut(s) 80, 198
Hin1I GRCGYC 2 cut(s) 91, 209
Hpy188I TCNGA 8 cut(s) 58, 81, 107, 130, 166, 189, 196, 233
Hpy99I CGWCG 2 cut(s) 77, 126
HpyCH4IV ACGT 3 cut(s) 72, 121, 180
HpyF10VI GCNNNNNNNGC 1 cut(s) 12
HpySE526I ACGT 3 cut(s) 72, 121, 180
Hsp92I GRCGYC 2 cut(s) 91, 209
Kzo9I GATC 1 cut(s) 125
MaeII ACGT 3 cut(s) 72, 121, 180
MalI GATC 1 cut(s) 127
MboI GATC 1 cut(s) 125
MboII GAAGA 7 cut(s) 30, 76, 94, 125, 151, 184, 251
MnlI CCTC 7 cut(s) 60, 64, 109, 113, 168, 235, 239
MwoI GCNNNNNNNGC 1 cut(s) 12
NdeII GATC 1 cut(s) 125
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
Sau3AI GATC 1 cut(s) 125
SetI ASST 3 cut(s) 75, 124, 183
TaiI ACGT 3 cut(s) 75, 124, 183
TaqI TCGA 1 cut(s) 124
TaqII GACCGA 3 cut(s) 41, 45, 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.