Rh6DG190800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0001084
Physical Location & Seq
Forward (+)
34172904 .. 34183013
10110 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG190800.1

Sequence Viewer

Length: 198 bp
ATGATGAAGCCATTTAATCTACAAATACCTTCATATCTTCCTCCAGGGGCAAGCAAGCGTCTTCCTCAAGACTTGTACTGGTCAATTCCGTCCACACATATCCTTCTATACATTAGATATTCTAGGACTCTAAGAGGAGTGTCTGATCCCGACAAACAAGTTCTATTTAAGGTAGAGATTCTGAAACAAACAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.6

Weight (kDa)

9.9

Isoelectric Point (pI)

53.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 140
AfaI GTAC 1 cut(s) 77
AjnI CCWGG 1 cut(s) 43
AlwI GGATC 1 cut(s) 140
BbsI GAAGAC 1 cut(s) 53
BciT130I CCWGG 1 cut(s) 45
BfaI CTAG 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 45
BmrFI CCNGG 1 cut(s) 45
BpiI GAAGAC 1 cut(s) 53
BpmI CTGGAG 1 cut(s) 27
BpuEI CTTGAG 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 44
Bse1I ACTGG 1 cut(s) 83
BseBI CCWGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 44
BseNI ACTGG 1 cut(s) 83
BseRI GAGGAG 1 cut(s) 150
Bsp143I GATC 1 cut(s) 145
BspPI GGATC 1 cut(s) 140
BsrI ACTGG 1 cut(s) 83
BssECI CCNNGG 1 cut(s) 44
BssMI GATC 1 cut(s) 145
Bst2UI CCWGG 1 cut(s) 45
BstC8I GCNNGC 2 cut(s) 52, 56
BstDEI CTNAG 1 cut(s) 131
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BstNI CCWGG 1 cut(s) 45
BstSCI CCNGG 1 cut(s) 43
BstV2I GAAGAC 1 cut(s) 53
Cac8I GCNNGC 2 cut(s) 52, 56
CseI GACGC 1 cut(s) 47
Csp6I GTAC 1 cut(s) 76
CviJI RGCY 1 cut(s) 10
CviKI_1 RGCY 1 cut(s) 10
CviQI GTAC 1 cut(s) 76
DdeI CTNAG 1 cut(s) 131
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
EcoRII CCWGG 1 cut(s) 43
FaiI YATR 3 cut(s) 34, 99, 109
FspBI CTAG 1 cut(s) 123
GsuI CTGGAG 1 cut(s) 27
HgaI GACGC 1 cut(s) 47
HinfI GANTC 2 cut(s) 127, 178
Hpy166II GTNNAC 1 cut(s) 93
Hpy188I TCNGA 2 cut(s) 145, 183
Hpy188III TCNNGA 2 cut(s) 68, 149
Hpy8I GTNNAC 1 cut(s) 93
HpyAV CCTTC 2 cut(s) 39, 113
HpyF3I CTNAG 1 cut(s) 131
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 3 cut(s) 30, 57, 64
MaeI CTAG 1 cut(s) 123
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 2 cut(s) 29, 53
MluCI AATT 2 cut(s) 84, 193
MlyI GAGTC 1 cut(s) 121
MnlI CCTC 3 cut(s) 51, 75, 128
MseI TTAA 2 cut(s) 15, 168
MspR9I CCNGG 1 cut(s) 45
MvaI CCWGG 1 cut(s) 45
NdeII GATC 1 cut(s) 145
PfeI GAWTC 1 cut(s) 178
PleI GAGTC 1 cut(s) 121
PpsI GAGTC 1 cut(s) 121
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
SaqAI TTAA 2 cut(s) 15, 168
Sau3AI GATC 1 cut(s) 145
SchI GAGTC 1 cut(s) 121
ScrFI CCNGG 1 cut(s) 45
SetI ASST 2 cut(s) 31, 174
SmlI CTYRAG 1 cut(s) 66
SmoI CTYRAG 1 cut(s) 66
Sse9I AATT 2 cut(s) 84, 193
SspMI CTAG 1 cut(s) 123
StyD4I CCNGG 1 cut(s) 43
TasI AATT 2 cut(s) 84, 193
TatI WGTACW 1 cut(s) 75
TfiI GAWTC 1 cut(s) 178
Tru1I TTAA 2 cut(s) 15, 168
Tru9I TTAA 2 cut(s) 15, 168
TspDTI ATGAA 2 cut(s) 20, 21
TspGWI ACGGA 1 cut(s) 78
XspI CTAG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.