Rh6BG433100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0000915
Physical Location & Seq
Reverse (-)
65338314 .. 65338724
411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG433100.1

Sequence Viewer

Length: 153 bp
ATGGATGGACAGCCCAATGACTGTCCTCCCTACAATACAAGAGCTCATAGGAAGTGGGATAAGCTTGTGGTTCTACAGCCTGCTGATGTTGAAGTTAAGCTGAACATTGCAATTAATGGTATTCTATGTACAGTGGAGACATTGATTCGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.66

Weight (kDa)

6.52

Isoelectric Point (pI)

39.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 130
AgsI TTSAA 1 cut(s) 92
AluBI AGCT 3 cut(s) 44, 64, 100
AluI AGCT 3 cut(s) 44, 64, 100
Alw21I GWGCWC 1 cut(s) 46
Alw26I GTCTC 1 cut(s) 131
AseI ATTAAT 1 cut(s) 114
BanII GRGCYC 1 cut(s) 46
Bbv12I GWGCWC 1 cut(s) 46
BcoDI GTCTC 1 cut(s) 131
BfmI CTRYAG 1 cut(s) 74
Bse3DI GCAATG 1 cut(s) 105
BseGI GGATG 1 cut(s) 10
BseMI GCAATG 1 cut(s) 105
BsiHKAI GWGCWC 1 cut(s) 46
BsmAI GTCTC 1 cut(s) 131
Bsp1286I GDGCHC 1 cut(s) 46
Bsp1407I TGTACA 1 cut(s) 128
BsrDI GCAATG 1 cut(s) 105
BsrGI TGTACA 1 cut(s) 128
Bst4CI ACNGT 2 cut(s) 23, 133
BstAUI TGTACA 1 cut(s) 128
BstC8I GCNNGC 1 cut(s) 81
BstF5I GGATG 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 131
BstSFI CTRYAG 1 cut(s) 74
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 138
Cac8I GCNNGC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 129
CviJI RGCY 5 cut(s) 13, 44, 64, 79, 100
CviKI_1 RGCY 5 cut(s) 13, 44, 64, 79, 100
CviQI GTAC 1 cut(s) 129
Ecl136II GAGCTC 1 cut(s) 44
Eco24I GRGCYC 1 cut(s) 46
Eco53kI GAGCTC 1 cut(s) 44
EcoICRI GAGCTC 1 cut(s) 44
EcoT38I GRGCYC 1 cut(s) 46
FaiI YATR 2 cut(s) 48, 127
FokI GGATG 1 cut(s) 17
FriOI GRGCYC 1 cut(s) 46
HindIII AAGCTT 1 cut(s) 62
HinfI GANTC 1 cut(s) 145
HpyCH4III ACNGT 2 cut(s) 23, 133
HpyCH4V TGCA 1 cut(s) 110
LpnPI CCDG 1 cut(s) 93
MhlI GDGCHC 1 cut(s) 46
MluCI AATT 1 cut(s) 111
MnlI CCTC 1 cut(s) 36
MseI TTAA 2 cut(s) 96, 114
PfeI GAWTC 1 cut(s) 145
PshBI ATTAAT 1 cut(s) 114
Psp124BI GAGCTC 1 cut(s) 46
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SacI GAGCTC 1 cut(s) 46
SaqAI TTAA 2 cut(s) 96, 114
SduI GDGCHC 1 cut(s) 46
SetI ASST 3 cut(s) 46, 66, 102
SfcI CTRYAG 1 cut(s) 74
SgeI CNNG 3 cut(s) 51, 77, 92
Sse9I AATT 1 cut(s) 111
SstI GAGCTC 1 cut(s) 46
TaaI ACNGT 2 cut(s) 23, 133
TasI AATT 1 cut(s) 111
TatI WGTACW 1 cut(s) 128
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 2 cut(s) 96, 114
Tru9I TTAA 2 cut(s) 96, 114
TscAI CASTG 1 cut(s) 138
TspRI CASTG 1 cut(s) 138
VspI ATTAAT 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.