FvH4_6g09311

Cytochrome p450

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
5522413 .. 5524626
2214 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g09311.t1

Sequence Viewer

Length: 285 bp
ATGGGTAAAGGAGTATGGTCCAGTATTCACGTACGCCACAGGCAGCCATCAATACCTCATTACCTTGTTATCAGCGATCCACATATAGTAAAGGAGATTAGAGTGCGCAACGCCACGGATTTGTGTAGACCAGCATATATGAATAAGAACTTCTACGCTTTAACAGGTGATAGCATTTTTCTCACCGACGGAGAAAAGTGGGCATACCAGAGGAAAGTTATCGCCCCTGAATTATACCATGACAAGGCTAAGCTGAAGGCTTTGTCTAGCCAGGGTTGTGGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.72

Weight (kDa)

9.55

Isoelectric Point (pI)

50.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 107
AccI GTMKAC 1 cut(s) 127
AclWI GGATC 1 cut(s) 71
AcuI CTGAAG 1 cut(s) 275
AfaI GTAC 1 cut(s) 33
AfiI CCNNNNNNNGG 1 cut(s) 244
AjnI CCWGG 1 cut(s) 270
AluBI AGCT 1 cut(s) 253
AluI AGCT 1 cut(s) 253
AlwI GGATC 1 cut(s) 71
ApeKI GCWGC 1 cut(s) 43
AspLEI GCGC 1 cut(s) 108
AspS9I GGNCC 1 cut(s) 18
AsuHPI GGTGA 2 cut(s) 175, 179
AvaII GGWCC 1 cut(s) 18
BbvI GCAGC 1 cut(s) 55
BccI CCATC 1 cut(s) 55
BciT130I CCWGG 1 cut(s) 272
BfaI CTAG 1 cut(s) 267
BisI GCNGC 1 cut(s) 44
BlpI GCTNAGC 1 cut(s) 249
BlsI GCNGC 1 cut(s) 45
Bme1390I CCNGG 1 cut(s) 272
Bme18I GGWCC 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 272
Bpu1102I GCTNAGC 1 cut(s) 249
BsaAI YACGTR 1 cut(s) 31
BsaJI CCNNGG 2 cut(s) 114, 271
Bsc4I CCNNNNNNNGG 1 cut(s) 244
Bse1I ACTGG 1 cut(s) 21
BseBI CCWGG 1 cut(s) 272
BseDI CCNNGG 2 cut(s) 114, 271
BseLI CCNNNNNNNGG 1 cut(s) 244
BseNI ACTGG 1 cut(s) 21
BseXI GCAGC 1 cut(s) 55
BsiWI CGTACG 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 244
Bsp143I GATC 1 cut(s) 76
Bsp1720I GCTNAGC 1 cut(s) 249
BspPI GGATC 1 cut(s) 71
BsrI ACTGG 1 cut(s) 21
BssECI CCNNGG 2 cut(s) 114, 271
BssMI GATC 1 cut(s) 76
Bst2UI CCWGG 1 cut(s) 272
BstBAI YACGTR 1 cut(s) 31
BstDEI CTNAG 1 cut(s) 249
BstDSI CCRYGG 1 cut(s) 114
BstHHI GCGC 1 cut(s) 108
BstKTI GATC 1 cut(s) 79
BstMBI GATC 1 cut(s) 76
BstNI CCWGG 1 cut(s) 272
BstSCI CCNGG 1 cut(s) 270
BstV1I GCAGC 1 cut(s) 55
BstXI CCANNNNNNTGG 1 cut(s) 278
BtgI CCRYGG 1 cut(s) 114
CfoI GCGC 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 18
Csp6I GTAC 1 cut(s) 32
CviAII CATG 1 cut(s) 239
CviJI RGCY 5 cut(s) 46, 248, 253, 260, 270
CviKI_1 RGCY 5 cut(s) 46, 248, 253, 260, 270
CviQI GTAC 1 cut(s) 32
DdeI CTNAG 1 cut(s) 249
DpnI GATC 1 cut(s) 78
DpnII GATC 1 cut(s) 76
Eco47I GGWCC 1 cut(s) 18
Eco57I CTGAAG 1 cut(s) 275
EcoRII CCWGG 1 cut(s) 270
FaeI CATG 1 cut(s) 242
FaiI YATR 9 cut(s) 16, 84, 86, 136, 138, 140, 205, 235, 240
FatI CATG 1 cut(s) 238
FblI GTMKAC 1 cut(s) 127
Fnu4HI GCNGC 1 cut(s) 44
Fsp4HI GCNGC 1 cut(s) 44
FspBI CTAG 1 cut(s) 267
FspI TGCGCA 1 cut(s) 107
GlaI GCGC 1 cut(s) 107
GluI GCNGC 1 cut(s) 44
HhaI GCGC 1 cut(s) 108
Hin1II CATG 1 cut(s) 242
Hin6I GCGC 1 cut(s) 106
HinP1I GCGC 1 cut(s) 106
HphI GGTGA 2 cut(s) 175, 179
Hpy166II GTNNAC 1 cut(s) 128
Hpy8I GTNNAC 1 cut(s) 128
Hpy99I CGWCG 1 cut(s) 191
HpyAV CCTTC 1 cut(s) 250
HpyCH4IV ACGT 1 cut(s) 30
HpyF3I CTNAG 1 cut(s) 249
HpySE526I ACGT 1 cut(s) 30
Hsp92II CATG 1 cut(s) 242
HspAI GCGC 1 cut(s) 106
Kzo9I GATC 1 cut(s) 76
LpnPI CCDG 7 cut(s) 25, 34, 144, 150, 221, 240, 257
Lsp1109I GCAGC 1 cut(s) 55
MaeI CTAG 1 cut(s) 267
MaeII ACGT 1 cut(s) 30
MalI GATC 1 cut(s) 78
MboI GATC 1 cut(s) 76
MluCI AATT 1 cut(s) 230
MnlI CCTC 2 cut(s) 66, 204
MseI TTAA 1 cut(s) 161
MspR9I CCNGG 1 cut(s) 272
MvaI CCWGG 1 cut(s) 272
NdeII GATC 1 cut(s) 76
NlaIII CATG 1 cut(s) 242
NsbI TGCGCA 1 cut(s) 107
Pfl23II CGTACG 1 cut(s) 31
PkrI GCNGC 1 cut(s) 45
Ppu21I YACGTR 1 cut(s) 31
Psp6I CCWGG 1 cut(s) 270
PspGI CCWGG 1 cut(s) 270
PspLI CGTACG 1 cut(s) 31
PspPI GGNCC 1 cut(s) 18
RsaI GTAC 1 cut(s) 33
RsaNI GTAC 1 cut(s) 32
SaqAI TTAA 1 cut(s) 161
SatI GCNGC 1 cut(s) 44
Sau3AI GATC 1 cut(s) 76
Sau96I GGNCC 1 cut(s) 18
ScrFI CCNGG 1 cut(s) 272
SetI ASST 5 cut(s) 33, 58, 66, 169, 255
SinI GGWCC 1 cut(s) 18
Sse9I AATT 1 cut(s) 230
SspMI CTAG 1 cut(s) 267
StyD4I CCNGG 1 cut(s) 270
TaiI ACGT 1 cut(s) 33
TasI AATT 1 cut(s) 230
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TseI GCWGC 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 155
TspGWI ACGGA 2 cut(s) 131, 204
VpaK11BI GGWCC 1 cut(s) 18
XmiI GTMKAC 1 cut(s) 127
XspI CTAG 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.