Rh3CG101800

Cytochrome p450

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0000980
Physical Location & Seq
Reverse (-)
8082529 .. 8083941
1413 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG101800.1

Sequence Viewer

Length: 651 bp
ATGGAGAAGATTCGGTCCACCGCCGATATCACCCAGAAAGCATCGAAAGGTGGGCATGTACAGCACGATTGGGCACCCTCCGTACACCCATTTCTTCATAAATGGGCAGACGAGTATGGTCCAGTATACATGTACTCCACAGGCAGCCAGCAACACCTTGTTGTAAGCGATCCACAGTTAATAAGAGAGCTTAGATCGCACAACTCCATGGATTTGGGTAGACCAACATATATGAATAAGAACTTGCAAGCTTTAACAGGTGATAGCTTTTTGGTCGCTAACGGAGAAAAGTGGGCTTACCAGAGGAAGATCATTGCCCCTAAATTTTTCCTTGACAAGGTTAAGGACATGTTAGGTCTGATGGTGAAATCCACAACGACAACGATTAAGGCATGGAAGAAATCTATACAAGAAAGCGATTCGGGCATTGTGGATATGAGAATTGATGAGGATTTGAAGGCCATATCTAGAGAAGTCCTATCAAGAGCTTGCTTCGGTGGGTCTTACTCTAAAGGCAACCAGATTTTTGCAACTATTTCTGTTCTGGAAGAAGCCTTGTCCGAACCAAATGTGTTCTCTGCGTTTCTAAACTTGAGGATATGTTCAAATCCTACAGATTCTTTCCCACAGAGAATTATGACAAGAAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
p450

Protein Analysis

216

Amino Acids

24.43

Weight (kDa)

9.16

Isoelectric Point (pI)

39.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 27 - 188 3.9e-15 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 73
AccI GTMKAC 2 cut(s) 126, 220
AciI CCGC 1 cut(s) 21
AclWI GGATC 1 cut(s) 164
AcsI RAATTY 1 cut(s) 323
AfaI GTAC 3 cut(s) 60, 84, 134
AfiI CCNNNNNNNGG 1 cut(s) 337
AflIII ACRYGT 2 cut(s) 129, 348
AgsI TTSAA 2 cut(s) 457, 606
AluBI AGCT 4 cut(s) 190, 251, 267, 488
AluI AGCT 4 cut(s) 190, 251, 267, 488
AlwI GGATC 1 cut(s) 164
AoxI GGCC 1 cut(s) 459
ApeKI GCWGC 1 cut(s) 144
ApoI RAATTY 1 cut(s) 323
AspS9I GGNCC 2 cut(s) 15, 119
AsuHPI GGTGA 3 cut(s) 22, 272, 376
AvaII GGWCC 2 cut(s) 15, 119
BaeGI GKGCMC 1 cut(s) 76
BanI GGYRCC 1 cut(s) 73
BbvI GCAGC 1 cut(s) 156
BccI CCATC 1 cut(s) 355
BfaI CTAG 1 cut(s) 468
BfmI CTRYAG 1 cut(s) 612
BisI GCNGC 1 cut(s) 145
BlsI GCNGC 1 cut(s) 146
Bme18I GGWCC 2 cut(s) 15, 119
BmgT120I GGNCC 2 cut(s) 15, 119
BmiI GGNNCC 1 cut(s) 75
BmsI GCATC 1 cut(s) 50
BpuEI CTTGAG 1 cut(s) 613
BsaJI CCNNGG 1 cut(s) 207
BsaXI ACNNNNNCTCC 2 cut(s) 119, 149
Bsc4I CCNNNNNNNGG 1 cut(s) 337
Bse1I ACTGG 1 cut(s) 122
Bse3DI GCAATG 1 cut(s) 312
BseDI CCNNGG 1 cut(s) 207
BseLI CCNNNNNNNGG 1 cut(s) 337
BseMI GCAATG 1 cut(s) 312
BseNI ACTGG 1 cut(s) 122
BseSI GKGCMC 1 cut(s) 76
BseXI GCAGC 1 cut(s) 156
BshFI GGCC 1 cut(s) 461
BshNI GGYRCC 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 337
BsnI GGCC 1 cut(s) 461
Bsp1286I GDGCHC 1 cut(s) 76
Bsp1407I TGTACA 1 cut(s) 58
Bsp143I GATC 3 cut(s) 169, 194, 309
Bsp19I CCATGG 1 cut(s) 207
BspACI CCGC 1 cut(s) 21
BspANI GGCC 1 cut(s) 461
BspLI GGNNCC 1 cut(s) 75
BspPI GGATC 1 cut(s) 164
BspT107I GGYRCC 1 cut(s) 73
BsrDI GCAATG 1 cut(s) 312
BsrGI TGTACA 1 cut(s) 58
BsrI ACTGG 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 207
BssMI GATC 3 cut(s) 169, 194, 309
BssNAI GTATAC 1 cut(s) 127
BssT1I CCWWGG 1 cut(s) 207
Bst1107I GTATAC 1 cut(s) 127
Bst4CI ACNGT 1 cut(s) 177
BstAUI TGTACA 1 cut(s) 58
BstC8I GCNNGC 3 cut(s) 149, 249, 490
BstDEI CTNAG 1 cut(s) 191
BstDSI CCRYGG 1 cut(s) 207
BstENI CCTNNNNNAGG 1 cut(s) 335
BstKTI GATC 3 cut(s) 172, 197, 312
BstMBI GATC 3 cut(s) 169, 194, 309
BstMWI GCNNNNNNNGC 3 cut(s) 61, 196, 423
BstNSI RCATGY 3 cut(s) 59, 133, 352
BstSFI CTRYAG 1 cut(s) 612
BstSLI GKGCMC 1 cut(s) 76
BstV1I GCAGC 1 cut(s) 156
BstXI CCANNNNNNTGG 1 cut(s) 214
BstZ17I GTATAC 1 cut(s) 127
BsuRI GGCC 1 cut(s) 461
BtgI CCRYGG 1 cut(s) 207
Cac8I GCNNGC 3 cut(s) 149, 249, 490
Cfr13I GGNCC 2 cut(s) 15, 119
Csp6I GTAC 3 cut(s) 59, 83, 133
CviAII CATG 5 cut(s) 56, 130, 208, 349, 393
CviJI RGCY 8 cut(s) 147, 190, 251, 267, 296, 461, 488, 554
CviKI_1 RGCY 8 cut(s) 147, 190, 251, 267, 296, 461, 488, 554
CviQI GTAC 3 cut(s) 59, 83, 133
DdeI CTNAG 1 cut(s) 191
DpnI GATC 3 cut(s) 171, 196, 311
DpnII GATC 3 cut(s) 169, 194, 309
Eco130I CCWWGG 1 cut(s) 207
Eco32I GATATC 1 cut(s) 28
Eco47I GGWCC 2 cut(s) 15, 119
EcoNI CCTNNNNNAGG 1 cut(s) 335
EcoRV GATATC 1 cut(s) 28
EcoT14I CCWWGG 1 cut(s) 207
ErhI CCWWGG 1 cut(s) 207
FaeI CATG 5 cut(s) 59, 133, 211, 352, 396
FatI CATG 5 cut(s) 55, 129, 207, 348, 392
FblI GTMKAC 2 cut(s) 126, 220
Fnu4HI GCNGC 1 cut(s) 145
Fsp4HI GCNGC 1 cut(s) 145
FspBI CTAG 1 cut(s) 468
GluI GCNGC 1 cut(s) 145
HaeIII GGCC 1 cut(s) 461
Hin1II CATG 5 cut(s) 59, 133, 211, 352, 396
HindIII AAGCTT 1 cut(s) 249
HinfI GANTC 3 cut(s) 10, 419, 617
HphI GGTGA 3 cut(s) 22, 272, 376
Hpy166II GTNNAC 4 cut(s) 18, 85, 127, 221
Hpy188I TCNGA 2 cut(s) 360, 562
Hpy188III TCNNGA 3 cut(s) 468, 483, 545
Hpy8I GTNNAC 4 cut(s) 18, 85, 127, 221
HpyAV CCTTC 1 cut(s) 451
HpyCH4III ACNGT 1 cut(s) 177
HpyCH4V TGCA 2 cut(s) 247, 530
HpyF10VI GCNNNNNNNGC 3 cut(s) 61, 196, 423
HpyF3I CTNAG 1 cut(s) 191
Hsp92II CATG 5 cut(s) 59, 133, 211, 352, 396
Kzo9I GATC 3 cut(s) 169, 194, 309
LpnPI CCDG 8 cut(s) 47, 126, 135, 161, 243, 314, 530, 533
Lsp1109I GCAGC 1 cut(s) 156
LweI GCATC 1 cut(s) 50
MaeI CTAG 1 cut(s) 468
MalI GATC 3 cut(s) 171, 196, 311
MboI GATC 3 cut(s) 169, 194, 309
MboII GAAGA 5 cut(s) 19, 86, 319, 409, 560
MhlI GDGCHC 1 cut(s) 76
MluCI AATT 3 cut(s) 323, 441, 633
MnlI CCTC 4 cut(s) 88, 297, 442, 588
MseI TTAA 4 cut(s) 179, 254, 342, 387
MwoI GCNNNNNNNGC 3 cut(s) 61, 196, 423
NcoI CCATGG 1 cut(s) 207
NdeII GATC 3 cut(s) 169, 194, 309
NlaIII CATG 5 cut(s) 59, 133, 211, 352, 396
NlaIV GGNNCC 1 cut(s) 75
NspI RCATGY 3 cut(s) 59, 133, 352
PciI ACATGT 2 cut(s) 129, 348
PfeI GAWTC 3 cut(s) 10, 419, 617
PkrI GCNGC 1 cut(s) 146
PscI ACATGT 2 cut(s) 129, 348
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 2 cut(s) 15, 119
RsaI GTAC 3 cut(s) 60, 84, 134
RsaNI GTAC 3 cut(s) 59, 83, 133
SaqAI TTAA 4 cut(s) 179, 254, 342, 387
SatI GCNGC 1 cut(s) 145
Sau3AI GATC 3 cut(s) 169, 194, 309
Sau96I GGNCC 2 cut(s) 15, 119
SduI GDGCHC 1 cut(s) 76
SetI ASST 9 cut(s) 52, 159, 192, 253, 262, 269, 342, 358, 490
SfaNI GCATC 1 cut(s) 50
SfcI CTRYAG 1 cut(s) 612
SinI GGWCC 2 cut(s) 15, 119
SmlI CTYRAG 1 cut(s) 592
SmoI CTYRAG 1 cut(s) 592
Sse9I AATT 3 cut(s) 323, 441, 633
SsiI CCGC 1 cut(s) 21
SspMI CTAG 1 cut(s) 468
StyI CCWWGG 1 cut(s) 207
TaaI ACNGT 1 cut(s) 177
TaqI TCGA 1 cut(s) 44
TasI AATT 3 cut(s) 323, 441, 633
TatI WGTACW 2 cut(s) 58, 132
TfiI GAWTC 3 cut(s) 10, 419, 617
Tru1I TTAA 4 cut(s) 179, 254, 342, 387
Tru9I TTAA 4 cut(s) 179, 254, 342, 387
TseI GCWGC 1 cut(s) 144
TspDTI ATGAA 2 cut(s) 86, 248
TspGWI ACGGA 2 cut(s) 70, 297
VpaK11BI GGWCC 2 cut(s) 15, 119
XagI CCTNNNNNAGG 1 cut(s) 335
XapI RAATTY 1 cut(s) 323
XbaI TCTAGA 1 cut(s) 467
XceI RCATGY 3 cut(s) 59, 133, 352
XmiI GTMKAC 2 cut(s) 126, 220
XspI CTAG 1 cut(s) 468
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.