Rroxscaffold_6G00420050

Cytochrome p450

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
41394848 .. 41397765
2918 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00420050.1

Sequence Viewer

Length: 534 bp
ATGGAAGTGAACGCATTACCGATATGGTGGTCAGTTTTGTTAATCGGTGTATCAAGCTTGGTAATCAAATTGCTTAACAAGTTGTGGTTCGAGCCTAGAAGGATTCGAACAGTGCTTTCGAAGCAAGGCATTAGAGGACCACGACCCACCTTCCCTTTCGGCAATGTCCCAGAGATGCAGAAGATTCAATCAACCATGATCAACAACACGCATGAAGAAATGGATGGTCAACATCTCAACCACAATTGGCTTTCCTCTGTATTTCCATATATTCATAAATGGGCAAAAGAGTATGGTCCAATATACATGTACTCCACAGGGATCAACCAACACCTATATGTGAGCGATCCGAAGTTGCTAATGGAGATAAAACAGCACAACTCCCTGGATCTGGGTAAACCTACATATCTGGGTAAACCACTCCGGCCCTTGTTAGGTGATGGCCTTCTCCGAACTAATGGAAAACAGTGGGCCGTCCAGAGGAAACTTCTTGCTCCTGAATTCTTCCTTGGCAAAGTTAAGGTTTCTTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

177

Amino Acids

20.4

Weight (kDa)

9.91

Isoelectric Point (pI)

36.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 88 - 171 7.6e-07 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 329, 341, 396
AcsI RAATTY 1 cut(s) 500
AfaI GTAC 1 cut(s) 311
AfiI CCNNNNNNNGG 3 cut(s) 391, 434, 480
AflIII ACRYGT 1 cut(s) 306
AgsI TTSAA 1 cut(s) 188
AjnI CCWGG 1 cut(s) 384
AjuI GAANNNNNNNTTGG 2 cut(s) 492, 524
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
AlwI GGATC 3 cut(s) 329, 341, 396
AoxI GGCC 3 cut(s) 425, 442, 471
ApoI RAATTY 1 cut(s) 500
AspS9I GGNCC 4 cut(s) 137, 296, 426, 471
AsuHPI GGTGA 1 cut(s) 449
AsuII TTCGAA 2 cut(s) 106, 119
AvaII GGWCC 2 cut(s) 137, 296
BccI CCATC 2 cut(s) 218, 434
BceAI ACGGC 1 cut(s) 458
BciT130I CCWGG 1 cut(s) 386
BclI TGATCA 1 cut(s) 198
BfaI CTAG 1 cut(s) 96
Bme1390I CCNGG 1 cut(s) 386
Bme18I GGWCC 2 cut(s) 137, 296
BmgT120I GGNCC 4 cut(s) 137, 296, 426, 471
BmrFI CCNGG 1 cut(s) 386
BmsI GCATC 1 cut(s) 165
Bpu14I TTCGAA 2 cut(s) 106, 119
BsaJI CCNNGG 2 cut(s) 384, 508
BsaXI ACNNNNNCTCC 2 cut(s) 296, 326
Bsc4I CCNNNNNNNGG 3 cut(s) 391, 434, 480
Bse3DI GCAATG 1 cut(s) 169
BseBI CCWGG 1 cut(s) 386
BseDI CCNNGG 2 cut(s) 384, 508
BseGI GGATG 1 cut(s) 229
BseLI CCNNNNNNNGG 3 cut(s) 391, 434, 480
BseMI GCAATG 1 cut(s) 169
BshFI GGCC 3 cut(s) 427, 444, 473
BsiSI CCGG 1 cut(s) 424
BslFI GGGAC 1 cut(s) 152
BslI CCNNNNNNNGG 3 cut(s) 391, 434, 480
BsmFI GGGAC 1 cut(s) 152
BsnI GGCC 3 cut(s) 427, 444, 473
Bsp119I TTCGAA 2 cut(s) 106, 119
Bsp143I GATC 4 cut(s) 198, 321, 346, 388
BspANI GGCC 3 cut(s) 427, 444, 473
BspPI GGATC 3 cut(s) 329, 341, 396
BspT104I TTCGAA 2 cut(s) 106, 119
BsrDI GCAATG 1 cut(s) 169
BssECI CCNNGG 2 cut(s) 384, 508
BssMI GATC 4 cut(s) 198, 321, 346, 388
BssT1I CCWWGG 1 cut(s) 508
Bst2UI CCWGG 1 cut(s) 386
Bst4CI ACNGT 2 cut(s) 112, 468
BstBI TTCGAA 2 cut(s) 106, 119
BstF5I GGATG 1 cut(s) 229
BstKTI GATC 4 cut(s) 201, 324, 349, 391
BstMBI GATC 4 cut(s) 198, 321, 346, 388
BstMWI GCNNNNNNNGC 1 cut(s) 121
BstNI CCWGG 1 cut(s) 386
BstNSI RCATGY 1 cut(s) 310
BstSCI CCNGG 1 cut(s) 384
BstX2I RGATCY 1 cut(s) 388
BstYI RGATCY 1 cut(s) 388
BsuRI GGCC 3 cut(s) 427, 444, 473
BtsCI GGATG 1 cut(s) 229
BtsIMutI CAGTG 2 cut(s) 117, 473
Cfr13I GGNCC 4 cut(s) 137, 296, 426, 471
Csp6I GTAC 1 cut(s) 310
CviAII CATG 3 cut(s) 196, 212, 307
CviJI RGCY 6 cut(s) 57, 94, 250, 427, 444, 473
CviKI_1 RGCY 6 cut(s) 57, 94, 250, 427, 444, 473
CviQI GTAC 1 cut(s) 310
DpnI GATC 4 cut(s) 200, 323, 348, 390
DpnII GATC 4 cut(s) 198, 321, 346, 388
Eco130I CCWWGG 1 cut(s) 508
Eco47I GGWCC 2 cut(s) 137, 296
EcoRI GAATTC 1 cut(s) 500
EcoRII CCWGG 1 cut(s) 384
EcoT14I CCWWGG 1 cut(s) 508
ErhI CCWWGG 1 cut(s) 508
FaeI CATG 3 cut(s) 199, 215, 310
FaqI GGGAC 1 cut(s) 152
FatI CATG 3 cut(s) 195, 211, 306
FbaI TGATCA 1 cut(s) 198
FokI GGATG 1 cut(s) 236
FspBI CTAG 1 cut(s) 96
HaeIII GGCC 3 cut(s) 427, 444, 473
HapII CCGG 1 cut(s) 424
Hin1II CATG 3 cut(s) 199, 215, 310
HincII GTYRAC 1 cut(s) 230
HindII GTYRAC 1 cut(s) 230
HindIII AAGCTT 1 cut(s) 55
HinfI GANTC 2 cut(s) 103, 184
HpaII CCGG 1 cut(s) 424
HphI GGTGA 1 cut(s) 449
Hpy166II GTNNAC 4 cut(s) 10, 230, 398, 416
Hpy188I TCNGA 2 cut(s) 351, 452
Hpy188III TCNNGA 2 cut(s) 478, 497
Hpy8I GTNNAC 4 cut(s) 10, 230, 398, 416
HpyAV CCTTC 3 cut(s) 93, 160, 455
HpyCH4III ACNGT 2 cut(s) 112, 468
HpyCH4V TGCA 1 cut(s) 178
HpyF10VI GCNNNNNNNGC 1 cut(s) 121
Hsp92II CATG 3 cut(s) 199, 215, 310
Ksp22I TGATCA 1 cut(s) 198
Kzo9I GATC 4 cut(s) 198, 321, 346, 388
LmnI GCTCC 1 cut(s) 499
LpnPI CCDG 9 cut(s) 183, 303, 371, 377, 395, 398, 437, 491, 510
LweI GCATC 1 cut(s) 165
MaeI CTAG 1 cut(s) 96
MalI GATC 4 cut(s) 200, 323, 348, 390
MboI GATC 4 cut(s) 198, 321, 346, 388
MboII GAAGA 4 cut(s) 193, 227, 496, 519
MfeI CAATTG 1 cut(s) 244
MflI RGATCY 1 cut(s) 388
MluCI AATT 3 cut(s) 68, 244, 500
MnlI CCTC 3 cut(s) 128, 265, 474
MseI TTAA 3 cut(s) 41, 75, 519
MslI CAYNNNNRTG 1 cut(s) 336
MspI CCGG 1 cut(s) 424
MspR9I CCNGG 1 cut(s) 386
MunI CAATTG 1 cut(s) 244
MvaI CCWGG 1 cut(s) 386
MwoI GCNNNNNNNGC 1 cut(s) 121
NdeII GATC 4 cut(s) 198, 321, 346, 388
NlaIII CATG 3 cut(s) 199, 215, 310
NspI RCATGY 1 cut(s) 310
NspV TTCGAA 2 cut(s) 106, 119
PciI ACATGT 1 cut(s) 306
PfeI GAWTC 2 cut(s) 103, 184
PscI ACATGT 1 cut(s) 306
Psp6I CCWGG 1 cut(s) 384
PspGI CCWGG 1 cut(s) 384
PspPI GGNCC 4 cut(s) 137, 296, 426, 471
PsuI RGATCY 1 cut(s) 388
RsaI GTAC 1 cut(s) 311
RsaNI GTAC 1 cut(s) 310
RseI CAYNNNNRTG 1 cut(s) 336
SaqAI TTAA 3 cut(s) 41, 75, 519
Sau3AI GATC 4 cut(s) 198, 321, 346, 388
Sau96I GGNCC 4 cut(s) 137, 296, 426, 471
ScrFI CCNGG 1 cut(s) 386
SetI ASST 6 cut(s) 59, 152, 336, 403, 439, 525
SfaNI GCATC 1 cut(s) 165
SfuI TTCGAA 2 cut(s) 106, 119
SinI GGWCC 2 cut(s) 137, 296
SmiMI CAYNNNNRTG 1 cut(s) 336
Sse9I AATT 3 cut(s) 68, 244, 500
SspMI CTAG 1 cut(s) 96
StyD4I CCNGG 1 cut(s) 384
StyI CCWWGG 1 cut(s) 508
TaaI ACNGT 2 cut(s) 112, 468
TaqI TCGA 3 cut(s) 90, 106, 119
TasI AATT 3 cut(s) 68, 244, 500
TatI WGTACW 1 cut(s) 309
TfiI GAWTC 2 cut(s) 103, 184
Tru1I TTAA 3 cut(s) 41, 75, 519
Tru9I TTAA 3 cut(s) 41, 75, 519
TscAI CASTG 2 cut(s) 117, 473
TspDTI ATGAA 2 cut(s) 228, 263
TspRI CASTG 2 cut(s) 117, 473
VpaK11BI GGWCC 2 cut(s) 137, 296
XapI RAATTY 1 cut(s) 500
XceI RCATGY 1 cut(s) 310
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.