FvH4_7g03550

DNAJ heat shock N-terminal domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
OG0001405
Physical Location & Seq
Forward (+)
3935646 .. 3936618
973 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g03550.t2

Sequence Viewer

Length: 432 bp
ATGCAGAGGCCTATTTCAAGCTCCAAAAGTTGGACGCTGCAATCAAACAGGCCACACAAGCGAGGAACCTCAACCCTAATCTGCCCAACGTCGACAATTTCATCACAGCATACAAGATTCACAAAGCCATGTCCAGCAAGAAAAACTGGGGCTTTCAAGCATGTTAAAGCTGCCTTGGACTTTCTCTCTGACCCAGTGAGAAAGAAGGATTATGACAAGTCTTTAATGTCGAAAAAGAAGGCTTATGCTGCTGCCGCCTCAAGGAAAGCCGCCGCGGCTGCTGCTGCAAAGGAGGTTCAGGCTGCTGCTGCAAGGAGTGAAATTAATTCACGCAAAAGACGTTCAAATCAGCCCATGAGTGAACTTGAGTATGGCATCAATCTAATCATGAAGTACTCACCAAAATACATGGAGCGCAAATTCTCAGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3444 DnaJ

Protein Analysis

144

Amino Acids

15.97

Weight (kDa)

10.52

Isoelectric Point (pI)

58.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DnaJ PF00226 57 - 118 2.9e-14 DnaJ domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 30
AccI GTMKAC 1 cut(s) 92
AccII CGCG 1 cut(s) 275
AciI CCGC 4 cut(s) 255, 270, 273, 275
AcsI RAATTY 1 cut(s) 419
AfaI GTAC 1 cut(s) 395
AfiI CCNNNNNNNGG 2 cut(s) 30, 261
AgsI TTSAA 3 cut(s) 18, 157, 345
AluBI AGCT 2 cut(s) 21, 170
AluI AGCT 2 cut(s) 21, 170
AoxI GGCC 2 cut(s) 8, 50
ApoI RAATTY 1 cut(s) 419
ArsI GACNNNNNNTTYG 1 cut(s) 411
AseI ATTAAT 1 cut(s) 324
AspLEI GCGC 1 cut(s) 417
AsuHPI GGTGA 1 cut(s) 390
BfaI CTAG 1 cut(s) 430
BglI GCCNNNNNGGC 1 cut(s) 275
BmcAI AGTACT 1 cut(s) 395
BmiI GGNNCC 1 cut(s) 67
BmrI ACTGGG 2 cut(s) 156, 188
BmsI GCATC 1 cut(s) 384
BmuI ACTGGG 2 cut(s) 156, 188
BpuEI CTTGAG 2 cut(s) 244, 386
BsaJI CCNNGG 2 cut(s) 174, 273
Bsc4I CCNNNNNNNGG 2 cut(s) 30, 261
Bse1I ACTGG 2 cut(s) 151, 194
BseDI CCNNGG 2 cut(s) 174, 273
BseLI CCNNNNNNNGG 2 cut(s) 30, 261
BseNI ACTGG 2 cut(s) 151, 194
Bsh1236I CGCG 1 cut(s) 275
BshFI GGCC 2 cut(s) 10, 52
BslI CCNNNNNNNGG 2 cut(s) 30, 261
BsnI GGCC 2 cut(s) 10, 52
BspACI CCGC 4 cut(s) 255, 270, 273, 275
BspANI GGCC 2 cut(s) 10, 52
BspFNI CGCG 1 cut(s) 275
BspHI TCATGA 1 cut(s) 387
BspLI GGNNCC 1 cut(s) 67
BsrI ACTGG 2 cut(s) 151, 194
BssECI CCNNGG 2 cut(s) 174, 273
BssT1I CCWWGG 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 424
BstDSI CCRYGG 1 cut(s) 273
BstFNI CGCG 1 cut(s) 275
BstHHI GCGC 1 cut(s) 417
BstMWI GCNNNNNNNGC 8 cut(s) 58, 248, 254, 275, 278, 281, 284, 308
BstNSI RCATGY 1 cut(s) 164
BstUI CGCG 1 cut(s) 275
BsuRI GGCC 2 cut(s) 10, 52
BtgI CCRYGG 1 cut(s) 273
BtsIMutI CAGTG 1 cut(s) 201
CciI TCATGA 1 cut(s) 387
CfoI GCGC 1 cut(s) 417
Cfr42I CCGCGG 1 cut(s) 276
CseI GACGC 1 cut(s) 43
Csp6I GTAC 1 cut(s) 394
CviAII CATG 5 cut(s) 129, 161, 355, 388, 409
CviQI GTAC 1 cut(s) 394
DdeI CTNAG 1 cut(s) 424
Eco130I CCWWGG 1 cut(s) 174
Eco147I AGGCCT 1 cut(s) 10
EcoT14I CCWWGG 1 cut(s) 174
ErhI CCWWGG 1 cut(s) 174
FaeI CATG 5 cut(s) 132, 164, 358, 391, 412
FaiI YATR 9 cut(s) 111, 130, 162, 213, 246, 356, 372, 389, 410
FatI CATG 5 cut(s) 128, 160, 354, 387, 408
FblI GTMKAC 1 cut(s) 92
FspBI CTAG 1 cut(s) 430
GlaI GCGC 1 cut(s) 416
HaeIII GGCC 2 cut(s) 10, 52
HgaI GACGC 1 cut(s) 43
HhaI GCGC 1 cut(s) 417
Hin1II CATG 5 cut(s) 132, 164, 358, 391, 412
Hin6I GCGC 1 cut(s) 415
HinP1I GCGC 1 cut(s) 415
HincII GTYRAC 1 cut(s) 93
HindII GTYRAC 1 cut(s) 93
HinfI GANTC 1 cut(s) 117
HphI GGTGA 1 cut(s) 390
Hpy166II GTNNAC 2 cut(s) 93, 362
Hpy188I TCNGA 1 cut(s) 190
Hpy188III TCNNGA 1 cut(s) 388
Hpy8I GTNNAC 2 cut(s) 93, 362
Hpy99I CGWCG 1 cut(s) 94
HpyAV CCTTC 2 cut(s) 199, 232
HpyCH4IV ACGT 2 cut(s) 89, 340
HpyCH4V TGCA 4 cut(s) 4, 40, 287, 311
HpyF10VI GCNNNNNNNGC 8 cut(s) 58, 248, 254, 275, 278, 281, 284, 308
HpyF3I CTNAG 1 cut(s) 424
HpySE526I ACGT 2 cut(s) 89, 340
Hsp92II CATG 5 cut(s) 132, 164, 358, 391, 412
HspAI GCGC 1 cut(s) 415
KspI CCGCGG 1 cut(s) 276
LmnI GCTCC 2 cut(s) 26, 412
LpnPI CCDG 5 cut(s) 34, 132, 147, 207, 284
LweI GCATC 1 cut(s) 384
MaeI CTAG 1 cut(s) 430
MaeII ACGT 2 cut(s) 89, 340
MluCI AATT 4 cut(s) 96, 321, 325, 419
MmeI TCCRAC 1 cut(s) 11
MnlI CCTC 4 cut(s) 56, 79, 268, 286
MseI TTAA 3 cut(s) 165, 224, 324
MspA1I CMGCKG 1 cut(s) 275
MvnI CGCG 1 cut(s) 275
MwoI GCNNNNNNNGC 8 cut(s) 58, 248, 254, 275, 278, 281, 284, 308
NlaIII CATG 5 cut(s) 132, 164, 358, 391, 412
NlaIV GGNNCC 1 cut(s) 67
NspI RCATGY 1 cut(s) 164
PagI TCATGA 1 cut(s) 387
PceI AGGCCT 1 cut(s) 10
PcsI WCGNNNNNNNCGW 1 cut(s) 337
PfeI GAWTC 1 cut(s) 117
PflMI CCANNNNNTGG 1 cut(s) 30
PshBI ATTAAT 1 cut(s) 324
PspN4I GGNNCC 1 cut(s) 67
RsaI GTAC 1 cut(s) 395
RsaNI GTAC 1 cut(s) 394
SacII CCGCGG 1 cut(s) 276
SalI GTCGAC 1 cut(s) 91
SaqAI TTAA 3 cut(s) 165, 224, 324
ScaI AGTACT 1 cut(s) 395
SetI ASST 6 cut(s) 23, 71, 92, 172, 297, 343
SfaNI GCATC 1 cut(s) 384
Sfr303I CCGCGG 1 cut(s) 276
SgrBI CCGCGG 1 cut(s) 276
SmlI CTYRAG 2 cut(s) 259, 365
SmoI CTYRAG 2 cut(s) 259, 365
Sse9I AATT 4 cut(s) 96, 321, 325, 419
SseBI AGGCCT 1 cut(s) 10
SsiI CCGC 4 cut(s) 255, 270, 273, 275
SspMI CTAG 1 cut(s) 430
StuI AGGCCT 1 cut(s) 10
StyI CCWWGG 1 cut(s) 174
TaiI ACGT 2 cut(s) 92, 343
TaqI TCGA 2 cut(s) 92, 230
TasI AATT 4 cut(s) 96, 321, 325, 419
TatI WGTACW 1 cut(s) 393
TauI GCSGC 4 cut(s) 257, 272, 275, 278
TfiI GAWTC 1 cut(s) 117
Tru1I TTAA 3 cut(s) 165, 224, 324
Tru9I TTAA 3 cut(s) 165, 224, 324
TscAI CASTG 1 cut(s) 201
TspDTI ATGAA 2 cut(s) 90, 404
TspRI CASTG 1 cut(s) 201
Van91I CCANNNNNTGG 1 cut(s) 30
VspI ATTAAT 1 cut(s) 324
XapI RAATTY 1 cut(s) 419
XceI RCATGY 1 cut(s) 164
XmiI GTMKAC 1 cut(s) 92
XspI CTAG 1 cut(s) 430
ZrmI AGTACT 1 cut(s) 395
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.