Rh1DG079600

DnaJ molecular chaperone homology domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0001405
Physical Location & Seq
Forward (+)
14527493 .. 14527771
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG079600.1

Sequence Viewer

Length: 279 bp
ATGGCCAGCAAGTACTCCTTTCCTCATGATCCCCTCGTCAACCTCACCATAATGACTGCTGTCAAGGCAAAAGACACTGCAGAAGAATTTTTGAAGCTTCAAAACTACGAGTTGGCGATCAAGCAGGCCATGGTAGCCAAACAATTCGACCCTAATTTGCAAGGTATCGATCATTTCATCCTTGCCTACCAGATTCATAAAGCCGTGTCGGAAAAGAAAGATTGGTATCATGTTCTTGGCTTCCAAGAGGTTACCGAGTATGCGACCATCAAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DnaJ

Protein Analysis

92

Amino Acids

10.63

Weight (kDa)

6.9

Isoelectric Point (pI)

36.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 23
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 86
AfaI GTAC 1 cut(s) 14
AgsI TTSAA 2 cut(s) 94, 101
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
AlwI GGATC 1 cut(s) 23
AoxI GGCC 2 cut(s) 3, 126
ApoI RAATTY 1 cut(s) 86
AsuHPI GGTGA 1 cut(s) 37
BalI TGGCCA 1 cut(s) 5
BccI CCATC 1 cut(s) 275
BceAI ACGGC 1 cut(s) 188
BfmI CTRYAG 1 cut(s) 78
BmcAI AGTACT 1 cut(s) 14
BoxI GACNNNNGTC 1 cut(s) 59
Bsa29I ATCGAT 1 cut(s) 168
BsaBI GATNNNNATC 1 cut(s) 225
BsaJI CCNNGG 1 cut(s) 129
Bse8I GATNNNNATC 1 cut(s) 225
BseCI ATCGAT 1 cut(s) 168
BseDI CCNNGG 1 cut(s) 129
BseGI GGATG 1 cut(s) 177
BseJI GATNNNNATC 1 cut(s) 225
BshFI GGCC 2 cut(s) 5, 128
BshVI ATCGAT 1 cut(s) 168
BsnI GGCC 2 cut(s) 5, 128
Bsp143I GATC 3 cut(s) 28, 117, 169
Bsp19I CCATGG 1 cut(s) 129
BspANI GGCC 2 cut(s) 5, 128
BspDI ATCGAT 1 cut(s) 168
BspHI TCATGA 1 cut(s) 25
BspMAI CTGCAG 1 cut(s) 82
BspPI GGATC 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 129
BssMI GATC 3 cut(s) 28, 117, 169
BssT1I CCWWGG 1 cut(s) 129
BstC8I GCNNGC 2 cut(s) 7, 126
BstDSI CCRYGG 1 cut(s) 129
BstEII GGTNACC 1 cut(s) 250
BstF5I GGATG 1 cut(s) 177
BstKTI GATC 3 cut(s) 31, 120, 172
BstMBI GATC 3 cut(s) 28, 117, 169
BstMWI GCNNNNNNNGC 2 cut(s) 65, 134
BstPAI GACNNNNGTC 1 cut(s) 59
BstPI GGTNACC 1 cut(s) 250
BstSFI CTRYAG 1 cut(s) 78
Bsu15I ATCGAT 1 cut(s) 168
BsuRI GGCC 2 cut(s) 5, 128
BsuTUI ATCGAT 1 cut(s) 168
BtgI CCRYGG 1 cut(s) 129
BtsCI GGATG 1 cut(s) 177
BtsI GCAGTG 1 cut(s) 75
BtsIMutI CAGTG 1 cut(s) 75
Cac8I GCNNGC 2 cut(s) 7, 126
CciI TCATGA 1 cut(s) 25
ClaI ATCGAT 1 cut(s) 168
Csp6I GTAC 1 cut(s) 13
CviAII CATG 3 cut(s) 26, 130, 230
CviJI RGCY 6 cut(s) 5, 97, 128, 137, 203, 240
CviKI_1 RGCY 6 cut(s) 5, 97, 128, 137, 203, 240
CviQI GTAC 1 cut(s) 13
DpnI GATC 3 cut(s) 30, 119, 171
DpnII GATC 3 cut(s) 28, 117, 169
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 129
Eco91I GGTNACC 1 cut(s) 250
EcoO65I GGTNACC 1 cut(s) 250
EcoT14I CCWWGG 1 cut(s) 129
ErhI CCWWGG 1 cut(s) 129
FaeI CATG 3 cut(s) 29, 133, 233
FaiI YATR 6 cut(s) 27, 50, 131, 198, 231, 261
FalI AAGNNNNNCTT 1 cut(s) 34
FatI CATG 3 cut(s) 25, 129, 229
FokI GGATG 1 cut(s) 164
HaeIII GGCC 2 cut(s) 5, 128
Hin1II CATG 3 cut(s) 29, 133, 233
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
HindIII AAGCTT 1 cut(s) 95
HinfI GANTC 1 cut(s) 193
HphI GGTGA 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 211
Hpy188III TCNNGA 2 cut(s) 26, 271
Hpy8I GTNNAC 1 cut(s) 40
HpyCH4V TGCA 2 cut(s) 80, 160
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 134
Hsp92II CATG 3 cut(s) 29, 133, 233
Kzo9I GATC 3 cut(s) 28, 117, 169
LpnPI CCDG 3 cut(s) 19, 110, 203
MaeIII GTNAC 1 cut(s) 250
MalI GATC 3 cut(s) 30, 119, 171
MboI GATC 3 cut(s) 28, 117, 169
MboII GAAGA 1 cut(s) 95
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 86, 143, 154
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 189
MnlI CCTC 4 cut(s) 33, 44, 53, 241
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 50
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 2 cut(s) 65, 134
NcoI CCATGG 1 cut(s) 129
NdeII GATC 3 cut(s) 28, 117, 169
NlaIII CATG 3 cut(s) 29, 133, 233
PagI TCATGA 1 cut(s) 25
PfeI GAWTC 1 cut(s) 193
PshAI GACNNNNGTC 1 cut(s) 59
PspEI GGTNACC 1 cut(s) 250
PstI CTGCAG 1 cut(s) 82
RsaI GTAC 1 cut(s) 14
RsaNI GTAC 1 cut(s) 13
RseI CAYNNNNRTG 1 cut(s) 50
Sau3AI GATC 3 cut(s) 28, 117, 169
ScaI AGTACT 1 cut(s) 14
SetI ASST 4 cut(s) 45, 99, 166, 252
SfcI CTRYAG 1 cut(s) 78
SmiMI CAYNNNNRTG 1 cut(s) 50
Sse9I AATT 3 cut(s) 86, 143, 154
StyI CCWWGG 1 cut(s) 129
TaqI TCGA 2 cut(s) 147, 168
TasI AATT 3 cut(s) 86, 143, 154
TatI WGTACW 1 cut(s) 12
TfiI GAWTC 1 cut(s) 193
TscAI CASTG 1 cut(s) 82
TspDTI ATGAA 2 cut(s) 166, 185
TspRI CASTG 1 cut(s) 82
XapI RAATTY 1 cut(s) 86
ZrmI AGTACT 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.