FvH4_7g27672

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
Physical Location & Seq
Forward (+)
20645392 .. 20645897
506 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g27672.t1

Sequence Viewer

Length: 228 bp
ATGGGTGTTAGTTTGAGAAGCGTTTATGAGTACGAGGATGAAAAGGTTAAGAGAAGAAACTACGATGGTCAATCCATAACGCAACTCCTCGAATTCTTGAGAAATGCATATCGACATCCAGGAGAAAACTCGATGGCAAAGCTTGACAAAGATGTCAGAGATGCATATTCTGGTTTCTTGCATCGCGTTTATGAGGTTTTATGCAGAGTCGAGGCAACGAGTTCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.79

Weight (kDa)

6.72

Isoelectric Point (pI)

41.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 152
AccII CGCG 1 cut(s) 186
AcsI RAATTY 1 cut(s) 92
AfaI GTAC 1 cut(s) 32
AjnI CCWGG 1 cut(s) 118
AluBI AGCT 1 cut(s) 142
AluI AGCT 1 cut(s) 142
ApoI RAATTY 1 cut(s) 92
BccI CCATC 2 cut(s) 59, 127
BciT130I CCWGG 1 cut(s) 120
Bme1390I CCNGG 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 120
BmsI GCATC 2 cut(s) 151, 190
BpuEI CTTGAG 1 cut(s) 118
BseBI CCWGG 1 cut(s) 120
BseGI GGATG 2 cut(s) 43, 115
BseRI GAGGAG 1 cut(s) 77
Bsh1236I CGCG 1 cut(s) 186
BspFNI CGCG 1 cut(s) 186
Bst2UI CCWGG 1 cut(s) 120
BstF5I GGATG 2 cut(s) 43, 115
BstFNI CGCG 1 cut(s) 186
BstNI CCWGG 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 118
BstUI CGCG 1 cut(s) 186
BtgZI GCGATG 1 cut(s) 167
BtsCI GGATG 2 cut(s) 43, 115
Csp6I GTAC 1 cut(s) 31
CviJI RGCY 1 cut(s) 142
CviKI_1 RGCY 1 cut(s) 142
CviQI GTAC 1 cut(s) 31
DrdI GACNNNNNNGTC 1 cut(s) 152
DseDI GACNNNNNNGTC 1 cut(s) 152
EcoRI GAATTC 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 118
EcoT22I ATGCAT 2 cut(s) 109, 166
FaiI YATR 6 cut(s) 27, 77, 109, 166, 192, 202
FokI GGATG 2 cut(s) 50, 102
HindIII AAGCTT 1 cut(s) 140
HinfI GANTC 1 cut(s) 207
Hpy188I TCNGA 1 cut(s) 158
Hpy188III TCNNGA 2 cut(s) 97, 225
HpyCH4V TGCA 4 cut(s) 107, 164, 181, 204
LpnPI CCDG 3 cut(s) 105, 132, 156
LweI GCATC 2 cut(s) 151, 190
MboII GAAGA 1 cut(s) 66
MluCI AATT 1 cut(s) 92
MlyI GAGTC 1 cut(s) 216
MnlI CCTC 4 cut(s) 28, 98, 187, 205
Mph1103I ATGCAT 2 cut(s) 109, 166
MseI TTAA 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
MvnI CGCG 1 cut(s) 186
NsiI ATGCAT 2 cut(s) 109, 166
PfoI TCCNGGA 1 cut(s) 118
PleI GAGTC 1 cut(s) 215
PpsI GAGTC 1 cut(s) 215
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
SaqAI TTAA 1 cut(s) 48
SchI GAGTC 1 cut(s) 216
ScrFI CCNGG 1 cut(s) 120
SetI ASST 3 cut(s) 48, 144, 198
SfaNI GCATC 2 cut(s) 151, 190
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
Sse9I AATT 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 118
TaqI TCGA 4 cut(s) 90, 112, 131, 210
TasI AATT 1 cut(s) 92
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TspDTI ATGAA 1 cut(s) 54
XapI RAATTY 1 cut(s) 92
Zsp2I ATGCAT 2 cut(s) 109, 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.