MD17G1269800.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0001767
Physical Location & Seq
Reverse (-)
32966046 .. 32967097
1052 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1269800.v1.1.491

Sequence Viewer

Length: 171 bp
ATGGTTTGGTTTGCAACATATTGCAATACAAGAAATATGTGGCTCGTGTGCTACGATCGTTTCGATTGCTATCTGAGACCTTGGTTAAACCGGAAAAATAATGCTACTAAAGTAGTGCCACTAGAACATAATAGCGATGATCTCAATCCATGGTGGTGCAATTTTATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.97

Weight (kDa)

7.66

Isoelectric Point (pI)

27.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw26I GTCTC 1 cut(s) 70
BauI CACGAG 1 cut(s) 44
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 1 cut(s) 122
BsaBI GATNNNNATC 2 cut(s) 69, 144
BsaI GGTCTC 1 cut(s) 70
BsaJI CCNNGG 2 cut(s) 80, 149
BsaWI WCCGGW 1 cut(s) 90
Bse8I GATNNNNATC 2 cut(s) 69, 144
BseDI CCNNGG 2 cut(s) 80, 149
BseJI GATNNNNATC 2 cut(s) 69, 144
BseMII CTCAG 1 cut(s) 65
Bsh1285I CGRYCG 1 cut(s) 58
BsiEI CGRYCG 1 cut(s) 58
BsiSI CCGG 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 70
Bso31I GGTCTC 1 cut(s) 70
Bsp143I GATC 2 cut(s) 55, 139
Bsp19I CCATGG 1 cut(s) 149
BspCNI CTCAG 1 cut(s) 66
BspTNI GGTCTC 1 cut(s) 70
BssECI CCNNGG 2 cut(s) 80, 149
BssMI GATC 2 cut(s) 55, 139
BssSI CACGAG 1 cut(s) 44
BssT1I CCWWGG 2 cut(s) 80, 149
Bst2BI CACGAG 1 cut(s) 44
BstDEI CTNAG 1 cut(s) 74
BstDSI CCRYGG 1 cut(s) 149
BstKTI GATC 2 cut(s) 58, 142
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 2 cut(s) 55, 139
BstMCI CGRYCG 1 cut(s) 58
BtgI CCRYGG 1 cut(s) 149
BtgZI GCGATG 1 cut(s) 150
CviAII CATG 1 cut(s) 150
CviJI RGCY 1 cut(s) 43
CviKI_1 RGCY 1 cut(s) 43
DdeI CTNAG 1 cut(s) 74
DpnI GATC 2 cut(s) 57, 141
DpnII GATC 2 cut(s) 55, 139
Eco130I CCWWGG 2 cut(s) 80, 149
Eco31I GGTCTC 1 cut(s) 70
EcoT14I CCWWGG 2 cut(s) 80, 149
ErhI CCWWGG 2 cut(s) 80, 149
FaeI CATG 1 cut(s) 153
FaiI YATR 6 cut(s) 19, 38, 129, 151, 167, 169
FatI CATG 1 cut(s) 149
FspBI CTAG 1 cut(s) 122
FspEI CC 9 cut(s) 25, 67, 76, 93, 104, 132, 136, 139, 162
HapII CCGG 1 cut(s) 91
Hin1II CATG 1 cut(s) 153
HpaII CCGG 1 cut(s) 91
Hpy188I TCNGA 1 cut(s) 75
HpyCH4V TGCA 3 cut(s) 14, 24, 159
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 1 cut(s) 153
Kzo9I GATC 2 cut(s) 55, 139
LpnPI CCDG 1 cut(s) 104
MaeI CTAG 1 cut(s) 122
MalI GATC 2 cut(s) 57, 141
MboI GATC 2 cut(s) 55, 139
MluCI AATT 1 cut(s) 160
MseI TTAA 1 cut(s) 86
MslI CAYNNNNRTG 1 cut(s) 154
MspI CCGG 1 cut(s) 91
NcoI CCATGG 1 cut(s) 149
NdeII GATC 2 cut(s) 55, 139
NlaIII CATG 1 cut(s) 153
PcsI WCGNNNNNNNCGW 2 cut(s) 51, 60
Ple19I CGATCG 1 cut(s) 58
PvuI CGATCG 1 cut(s) 58
RseI CAYNNNNRTG 1 cut(s) 154
SaqAI TTAA 1 cut(s) 86
Sau3AI GATC 2 cut(s) 55, 139
SetI ASST 1 cut(s) 82
SgeI CNNG 7 cut(s) 42, 56, 58, 93, 103, 134, 162
SmiMI CAYNNNNRTG 1 cut(s) 154
Sse9I AATT 1 cut(s) 160
SspMI CTAG 1 cut(s) 122
StyI CCWWGG 2 cut(s) 80, 149
TaqI TCGA 1 cut(s) 63
TasI AATT 1 cut(s) 160
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
XspI CTAG 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.