MD00G1175800.v1.1

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0001684
Physical Location & Seq
Reverse (-)
40716624 .. 40717076
453 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1175800.v1.1.491

Sequence Viewer

Length: 453 bp
ATGCTAGTCCACGGGATTCCTCTTGATGATGTAACCTTCCTTGGCTTGTTATCAGCATGTAGTCACGCATGTCTAGTTGATCAAGGGTTGATGATTTTCAATGCTATGAAAAATGTTTATCGGATTGCCCTTCAAACACTGCACTATGCCTGCCTAGTTGATATGTATGGTCGAGCAAGGTTCTTAGAGGAAGCAGAGAATTTCATGAAGGAAATGCCAACAGAAGCAGACGGCGTTGTTTGGGGAGCGTTGCTTAATGCATGCAAAATTCATGGGAATGAGAAGATGCTTAAGAGGATCAGAAATGGTCTCCTCAAGAGTAGAGGAGTAGGCATCGGAACTTATGCTCTCGTATCGAATACATACGCCACTCACGAACGGTGGGATGAGGCTAATAAGGTTCGTGATGAAATGAGACAAATGGGGTTGAAGAAATTAGCTACGTACAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PPR PPR_2

Protein Analysis

151

Amino Acids

16.9

Weight (kDa)

8.35

Isoelectric Point (pI)

38.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
E_motif PF20431 113 - 145 2.3e-07 E motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 305
AcsI RAATTY 2 cut(s) 199, 267
AfaI GTAC 1 cut(s) 446
AflII CTTAAG 1 cut(s) 290
AgsI TTSAA 3 cut(s) 100, 134, 430
AluBI AGCT 1 cut(s) 440
AluI AGCT 1 cut(s) 440
Alw26I GTCTC 2 cut(s) 314, 409
AlwI GGATC 1 cut(s) 305
ApoI RAATTY 2 cut(s) 199, 267
BceAI ACGGC 1 cut(s) 247
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 2 cut(s) 314, 409
BfaI CTAG 3 cut(s) 5, 74, 155
BfrI CTTAAG 1 cut(s) 290
BmsI GCATC 2 cut(s) 276, 342
BpuEI CTTGAG 1 cut(s) 299
BsaAI YACGTR 1 cut(s) 444
BsaI GGTCTC 1 cut(s) 314
BsaJI CCNNGG 2 cut(s) 10, 40
BseDI CCNNGG 2 cut(s) 10, 40
BseGI GGATG 1 cut(s) 391
BseRI GAGGAG 2 cut(s) 302, 339
BsgI GTGCAG 1 cut(s) 125
BsmAI GTCTC 2 cut(s) 314, 409
Bso31I GGTCTC 1 cut(s) 314
Bsp143I GATC 2 cut(s) 79, 297
BspHI TCATGA 1 cut(s) 204
BspPI GGATC 1 cut(s) 305
BspTI CTTAAG 1 cut(s) 290
BspTNI GGTCTC 1 cut(s) 314
BssECI CCNNGG 2 cut(s) 10, 40
BssMI GATC 2 cut(s) 79, 297
BssT1I CCWWGG 1 cut(s) 40
Bst4CI ACNGT 2 cut(s) 381, 449
BstAFI CTTAAG 1 cut(s) 290
BstBAI YACGTR 1 cut(s) 444
BstC8I GCNNGC 2 cut(s) 151, 262
BstDEI CTNAG 1 cut(s) 184
BstDSI CCRYGG 1 cut(s) 10
BstF5I GGATG 1 cut(s) 391
BstKTI GATC 2 cut(s) 82, 300
BstMAI GTCTC 2 cut(s) 314, 409
BstMBI GATC 2 cut(s) 79, 297
BstNSI RCATGY 3 cut(s) 60, 72, 264
BstSNI TACGTA 1 cut(s) 444
BtgI CCRYGG 1 cut(s) 10
BtsCI GGATG 1 cut(s) 391
BtsI GCAGTG 1 cut(s) 137
BtsIMutI CAGTG 1 cut(s) 137
Cac8I GCNNGC 2 cut(s) 151, 262
CciI TCATGA 1 cut(s) 204
Csp6I GTAC 1 cut(s) 445
CviAII CATG 5 cut(s) 57, 69, 205, 261, 272
CviJI RGCY 3 cut(s) 45, 392, 440
CviKI_1 RGCY 3 cut(s) 45, 392, 440
CviQI GTAC 1 cut(s) 445
DdeI CTNAG 1 cut(s) 184
DpnI GATC 2 cut(s) 81, 299
DpnII GATC 2 cut(s) 79, 297
Eco105I TACGTA 1 cut(s) 444
Eco130I CCWWGG 1 cut(s) 40
Eco31I GGTCTC 1 cut(s) 314
EcoT14I CCWWGG 1 cut(s) 40
EcoT22I ATGCAT 1 cut(s) 262
ErhI CCWWGG 1 cut(s) 40
FaeI CATG 5 cut(s) 60, 72, 208, 264, 275
FatI CATG 5 cut(s) 56, 68, 204, 260, 271
FbaI TGATCA 1 cut(s) 79
FokI GGATG 1 cut(s) 398
FspBI CTAG 3 cut(s) 5, 74, 155
Hin1II CATG 5 cut(s) 60, 72, 208, 264, 275
HinfI GANTC 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 10
Hpy188I TCNGA 3 cut(s) 123, 302, 338
Hpy188III TCNNGA 5 cut(s) 23, 205, 316, 374, 404
Hpy8I GTNNAC 1 cut(s) 10
HpyAV CCTTC 3 cut(s) 46, 140, 202
HpyCH4III ACNGT 2 cut(s) 381, 449
HpyCH4IV ACGT 1 cut(s) 443
HpyCH4V TGCA 3 cut(s) 142, 260, 264
HpyF3I CTNAG 1 cut(s) 184
HpySE526I ACGT 1 cut(s) 443
Hsp92II CATG 5 cut(s) 60, 72, 208, 264, 275
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 2 cut(s) 79, 297
LmnI GCTCC 1 cut(s) 245
LpnPI CCDG 1 cut(s) 163
LweI GCATC 2 cut(s) 276, 342
MaeI CTAG 3 cut(s) 5, 74, 155
MaeII ACGT 1 cut(s) 443
MaeIII GTNAC 2 cut(s) 31, 62
MalI GATC 2 cut(s) 81, 299
MboI GATC 2 cut(s) 79, 297
MboII GAAGA 2 cut(s) 295, 442
MluCI AATT 3 cut(s) 199, 267, 434
MnlI CCTC 6 cut(s) 30, 181, 288, 317, 323, 382
Mph1103I ATGCAT 1 cut(s) 262
MseI TTAA 2 cut(s) 255, 291
MslI CAYNNNNRTG 1 cut(s) 276
MspCI CTTAAG 1 cut(s) 290
NdeII GATC 2 cut(s) 79, 297
NlaIII CATG 5 cut(s) 60, 72, 208, 264, 275
NmuCI GTSAC 1 cut(s) 62
NsiI ATGCAT 1 cut(s) 262
NspI RCATGY 3 cut(s) 60, 72, 264
PaeI GCATGC 1 cut(s) 264
PagI TCATGA 1 cut(s) 204
PcsI WCGNNNNNNNCGW 1 cut(s) 372
PfeI GAWTC 1 cut(s) 16
Ppu21I YACGTR 1 cut(s) 444
RsaI GTAC 1 cut(s) 446
RsaNI GTAC 1 cut(s) 445
RseI CAYNNNNRTG 1 cut(s) 276
SaqAI TTAA 2 cut(s) 255, 291
Sau3AI GATC 2 cut(s) 79, 297
SetI ASST 5 cut(s) 38, 182, 402, 442, 446
SfaNI GCATC 2 cut(s) 276, 342
SmiMI CAYNNNNRTG 1 cut(s) 276
SmlI CTYRAG 2 cut(s) 290, 314
SmoI CTYRAG 2 cut(s) 290, 314
SnaBI TACGTA 1 cut(s) 444
SphI GCATGC 1 cut(s) 264
Sse9I AATT 3 cut(s) 199, 267, 434
SspMI CTAG 3 cut(s) 5, 74, 155
StyI CCWWGG 1 cut(s) 40
TaaI ACNGT 2 cut(s) 381, 449
TaiI ACGT 1 cut(s) 446
TaqI TCGA 2 cut(s) 172, 356
TasI AATT 3 cut(s) 199, 267, 434
TfiI GAWTC 1 cut(s) 16
Tru1I TTAA 2 cut(s) 255, 291
Tru9I TTAA 2 cut(s) 255, 291
TscAI CASTG 1 cut(s) 144
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 5 cut(s) 122, 193, 221, 260, 423
TspRI CASTG 1 cut(s) 144
Vha464I CTTAAG 1 cut(s) 290
XapI RAATTY 2 cut(s) 199, 267
XceI RCATGY 3 cut(s) 60, 72, 264
XspI CTAG 3 cut(s) 5, 74, 155
Zsp2I ATGCAT 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.