Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000003

Orthogroup ID

OG0001684

Physical Location & Seq

Genomic Coordinates Forward (+)

12569549 .. 12575621

Gene Structure 6073 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_3G00228230.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 414 bp

ATGTATGGTCGAGCTGGGTTCTTAGAGGAAGCAGAGGCTTTTATTAAAGAAATTCCAATGGAAGCTGATGGTCCTGTTTGGGGAGCGCTGGTTTATGCGTGCAAAATTCATGGGAATAATGAGATGGTTGAGAGGATCAGAGAAGGCCTCTGCAATAGTGCACGAATGAACCATAGGCCTAACTGTATAATTTTTCCTATCGCACGTACAAGTGTTAAATATCATACTGAATTGAGATCCCAACAATTCAATTATGTAGCTAGGTTGAGGTTTAGATGGAGGGAAAAGATGGAAAGATATATAATTGGGCTGAGGTTTAAAGTAAAAGCTTGTCCAAGGATAGAAGATGAGGTTGTTGTTGTTACATATCTCCTCGTGCATCGCTGGGTAGATTCCTCGTGCATCATTGGGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2

Protein Analysis

137

Amino Acids

16.08

Weight (kDa)

9.08

Isoelectric Point (pI)

49.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001684)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g10870 FvH4_4g10872 FvH4_5g33630 FvH4_5g33630 FvH4_5g33630
malus_domestica	MD00G1175800.v1.1 MD00G1175900.v1.1 MD02G1110200.v1.1 MD02G1134900.v1.1 MD02G1135000.v1.1 MD02G1135100.v1.1 MD03G1186500.v1.1
prunus_persica	Prupe.4G247500_v2.0.a1 Prupe.5G045600_v2.0.a1
pyrus_communis	pycom03g13340 pycom03g13880
rosa_chinensis	RchiOBHm_Chr4g0406551 RchiOBHm_Chr4g0406561 RchiOBHm_Chr4g0406571 RchiOBHm_Chr7g0232221 RchiOBHm_Chr7g0232571
rosa_laevigata	RLG00000001323 RLG00000001326 RLG00000008766 RLG00000012933
rosa_multiflora	Rmu_sc0005505.1_g000001 Rmu_sc0020055.1_g000001 Rmu_ssc0000186.1_g000036
rosa_roxburghii	Rroxscaffold_3G00228190 Rroxscaffold_3G00228220 Rroxscaffold_3G00228230 Rroxscaffold_5G00351430
rosa_rugosa	Rorug04G0072200 Rorug07G0270300 Rorug07G0275100 Rorug07G0275100
rosa_samantha	Rh4AG139300 Rh4BG136400 Rh4CG146500 Rh4DG133700 Rh7AG429400 Rh7AG429600 Rh7BG399000 Rh7BG403100 Rh7BG403300 Rh7CG448200 Rh7CG448500
rosa_wichuraiana	Rw7G035240 Rw7G035490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	143, 231
AcsI	RAATTY	2 cut(s)	51, 105
AfaI	GTAC	1 cut(s)	208
AfeI	AGCGCT	1 cut(s)	87
AfiI	CCNNNNNNNGG	1 cut(s)	80
AgsI	TTSAA	1 cut(s)	250
AluBI	AGCT	4 cut(s)	14, 65, 260, 329
AluI	AGCT	4 cut(s)	14, 65, 260, 329
Alw21I	GWGCWC	1 cut(s)	163
Alw44I	GTGCAC	1 cut(s)	159
AlwI	GGATC	2 cut(s)	143, 231
Aor51HI	AGCGCT	1 cut(s)	87
AoxI	GGCC	2 cut(s)	145, 176
ApaLI	GTGCAC	1 cut(s)	159
ApoI	RAATTY	2 cut(s)	51, 105
AspLEI	GCGC	1 cut(s)	88
AspS9I	GGNCC	1 cut(s)	71
AvaII	GGWCC	1 cut(s)	71
BaeGI	GKGCMC	1 cut(s)	163
BauI	CACGAG	2 cut(s)	374, 397
Bbv12I	GWGCWC	1 cut(s)	163
BbvCI	CCTCAGC	1 cut(s)	311
BccI	CCATC	4 cut(s)	62, 118, 270, 283
BfaI	CTAG	1 cut(s)	261
BfoI	RGCGCY	1 cut(s)	89
Bme18I	GGWCC	1 cut(s)	71
BmgT120I	GGNCC	1 cut(s)	71
BmsI	GCATC	1 cut(s)	388
BplI	GAGNNNNNCTC	2 cut(s)	132, 164
Bpu10I	CCTNAGC	1 cut(s)	311
BsaAI	YACGTR	1 cut(s)	206
BsaJI	CCNNGG	1 cut(s)	335
BsaXI	ACNNNNNCTCC	2 cut(s)	75, 105
Bsc4I	CCNNNNNNNGG	1 cut(s)	80
BseDI	CCNNGG	1 cut(s)	335
BseLI	CCNNNNNNNGG	1 cut(s)	80
BseMII	CTCAG	1 cut(s)	302
BseRI	GAGGAG	1 cut(s)	362
BseSI	GKGCMC	1 cut(s)	163
BseYI	CCCAGC	2 cut(s)	14, 384
BshFI	GGCC	2 cut(s)	147, 178
BsiHKAI	GWGCWC	1 cut(s)	163
BslI	CCNNNNNNNGG	1 cut(s)	80
BsnI	GGCC	2 cut(s)	147, 178
Bsp1286I	GDGCHC	1 cut(s)	163
Bsp143I	GATC	2 cut(s)	135, 236
BspANI	GGCC	2 cut(s)	147, 178
BspCNI	CTCAG	1 cut(s)	303
BspPI	GGATC	2 cut(s)	143, 231
BssECI	CCNNGG	1 cut(s)	335
BssMI	GATC	2 cut(s)	135, 236
BssSI	CACGAG	2 cut(s)	374, 397
BssT1I	CCWWGG	1 cut(s)	335
Bst2BI	CACGAG	2 cut(s)	374, 397
Bst4CI	ACNGT	1 cut(s)	185
BstBAI	YACGTR	1 cut(s)	206
BstC8I	GCNNGC	1 cut(s)	100
BstDEI	CTNAG	2 cut(s)	22, 311
BstH2I	RGCGCY	1 cut(s)	89
BstHHI	GCGC	1 cut(s)	88
BstKTI	GATC	2 cut(s)	138, 239
BstMBI	GATC	2 cut(s)	135, 236
BstSLI	GKGCMC	1 cut(s)	163
BstX2I	RGATCY	1 cut(s)	236
BstYI	RGATCY	1 cut(s)	236
BsuRI	GGCC	2 cut(s)	147, 178
BtgZI	GCGATG	1 cut(s)	365
Cac8I	GCNNGC	1 cut(s)	100
CfoI	GCGC	1 cut(s)	88
Cfr13I	GGNCC	1 cut(s)	71
Csp6I	GTAC	1 cut(s)	207
CviAII	CATG	1 cut(s)	110
CviJI	RGCY	8 cut(s)	14, 38, 65, 147, 178, 260, 310, 329
CviKI_1	RGCY	8 cut(s)	14, 38, 65, 147, 178, 260, 310, 329
CviQI	GTAC	1 cut(s)	207
DdeI	CTNAG	2 cut(s)	22, 311
DpnI	GATC	2 cut(s)	137, 238
DpnII	GATC	2 cut(s)	135, 236
DraI	TTTAAA	1 cut(s)	319
Eco130I	CCWWGG	1 cut(s)	335
Eco147I	AGGCCT	2 cut(s)	147, 178
Eco47I	GGWCC	1 cut(s)	71
Eco47III	AGCGCT	1 cut(s)	87
EcoT14I	CCWWGG	1 cut(s)	335
ErhI	CCWWGG	1 cut(s)	335
FaeI	CATG	1 cut(s)	113
FatI	CATG	1 cut(s)	109
FspBI	CTAG	1 cut(s)	261
GlaI	GCGC	1 cut(s)	87
GsaI	CCCAGC	2 cut(s)	18, 388
HaeII	RGCGCY	1 cut(s)	89
HaeIII	GGCC	2 cut(s)	147, 178
HhaI	GCGC	1 cut(s)	88
Hin1II	CATG	1 cut(s)	113
Hin6I	GCGC	1 cut(s)	86
HinP1I	GCGC	1 cut(s)	86
HindIII	AAGCTT	1 cut(s)	327
HinfI	GANTC	1 cut(s)	392
Hpy166II	GTNNAC	1 cut(s)	161
Hpy188I	TCNGA	1 cut(s)	140
Hpy8I	GTNNAC	1 cut(s)	161
HpyAV	CCTTC	1 cut(s)	137
HpyCH4III	ACNGT	1 cut(s)	185
HpyCH4IV	ACGT	1 cut(s)	205
HpyCH4V	TGCA	5 cut(s)	102, 153, 161, 379, 402
HpyF3I	CTNAG	2 cut(s)	22, 311
HpySE526I	ACGT	1 cut(s)	205
Hsp92II	CATG	1 cut(s)	113
HspAI	GCGC	1 cut(s)	86
Kzo9I	GATC	2 cut(s)	135, 236
LmnI	GCTCC	1 cut(s)	83
LpnPI	CCDG	3 cut(s)	74, 87, 370
LweI	GCATC	1 cut(s)	388
MaeI	CTAG	1 cut(s)	261
MaeII	ACGT	1 cut(s)	205
MaeIII	GTNAC	1 cut(s)	361
MalI	GATC	2 cut(s)	137, 238
MboI	GATC	2 cut(s)	135, 236
MboII	GAAGA	1 cut(s)	356
MflI	RGATCY	1 cut(s)	236
MhlI	GDGCHC	1 cut(s)	163
MluCI	AATT	7 cut(s)	51, 105, 189, 230, 245, 250, 303
MseI	TTAA	3 cut(s)	45, 216, 318
NdeII	GATC	2 cut(s)	135, 236
NlaIII	CATG	1 cut(s)	113
PceI	AGGCCT	2 cut(s)	147, 178
PfeI	GAWTC	1 cut(s)	392
Ppu21I	YACGTR	1 cut(s)	206
PspFI	CCCAGC	2 cut(s)	14, 384
PspPI	GGNCC	1 cut(s)	71
PsuI	RGATCY	1 cut(s)	236
RsaI	GTAC	1 cut(s)	208
RsaNI	GTAC	1 cut(s)	207
SaqAI	TTAA	3 cut(s)	45, 216, 318
Sau3AI	GATC	2 cut(s)	135, 236
Sau96I	GGNCC	1 cut(s)	71
SduI	GDGCHC	1 cut(s)	163
SetI	ASST	9 cut(s)	16, 67, 208, 262, 266, 272, 317, 331, 354
SfaNI	GCATC	1 cut(s)	388
SinI	GGWCC	1 cut(s)	71
Sse9I	AATT	7 cut(s)	51, 105, 189, 230, 245, 250, 303
SseBI	AGGCCT	2 cut(s)	147, 178
SspMI	CTAG	1 cut(s)	261
StuI	AGGCCT	2 cut(s)	147, 178
StyI	CCWWGG	1 cut(s)	335
TaaI	ACNGT	1 cut(s)	185
TaiI	ACGT	1 cut(s)	208
TaqI	TCGA	1 cut(s)	10
TasI	AATT	7 cut(s)	51, 105, 189, 230, 245, 250, 303
TfiI	GAWTC	1 cut(s)	392
Tru1I	TTAA	3 cut(s)	45, 216, 318
Tru9I	TTAA	3 cut(s)	45, 216, 318
TspDTI	ATGAA	2 cut(s)	98, 182
VneI	GTGCAC	1 cut(s)	159
VpaK11BI	GGWCC	1 cut(s)	71
XapI	RAATTY	2 cut(s)	51, 105
XspI	CTAG	1 cut(s)	261

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.