MD02G1135000.v1.1

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Reverse (-)
11006698 .. 11007015
318 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1135000.v1.1.491

Sequence Viewer

Length: 318 bp
ATGCTAGTCCACGGGATTCCTCTTGATGATGTAACCTTCCTTGGCTTGTTATCAGCATGTAGTCACGAATGTCTAGTTGATCAAGGGTTGATGATTTTCAATGCTATGAAAAATGTTTATTGGATTGCCCCTCAAACACTGCACTATGCCTGCCTAGTTGATATGTATGGTCGAGCAGGGTTCTTAGAAGAAGCAGAGAATTTCATGAAGGAAATGCCAACAGAAGCAGACGGCGTTGTTTGGGGAGCGTTGCTTAATGCATGCAAAATTCATGGGAATGAGAAGATGCTTAAGAGGATCAGAAATGGTCTCCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

11.76

Weight (kDa)

5.42

Isoelectric Point (pI)

44.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 305
AcsI RAATTY 2 cut(s) 199, 267
AflII CTTAAG 1 cut(s) 290
AgsI TTSAA 1 cut(s) 100
Alw26I GTCTC 1 cut(s) 314
AlwI GGATC 1 cut(s) 305
ApoI RAATTY 2 cut(s) 199, 267
BceAI ACGGC 1 cut(s) 247
BclI TGATCA 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 314
BfaI CTAG 4 cut(s) 5, 74, 155, 316
BfrI CTTAAG 1 cut(s) 290
BmsI GCATC 1 cut(s) 276
BsaI GGTCTC 1 cut(s) 314
BsaJI CCNNGG 2 cut(s) 10, 40
BseDI CCNNGG 2 cut(s) 10, 40
BseRI GAGGAG 1 cut(s) 302
BsgI GTGCAG 1 cut(s) 125
BsmAI GTCTC 1 cut(s) 314
Bso31I GGTCTC 1 cut(s) 314
Bsp143I GATC 2 cut(s) 79, 297
BspHI TCATGA 1 cut(s) 204
BspPI GGATC 1 cut(s) 305
BspTI CTTAAG 1 cut(s) 290
BspTNI GGTCTC 1 cut(s) 314
BssECI CCNNGG 2 cut(s) 10, 40
BssMI GATC 2 cut(s) 79, 297
BssT1I CCWWGG 1 cut(s) 40
BstAFI CTTAAG 1 cut(s) 290
BstC8I GCNNGC 2 cut(s) 151, 262
BstDEI CTNAG 1 cut(s) 184
BstDSI CCRYGG 1 cut(s) 10
BstKTI GATC 2 cut(s) 82, 300
BstMAI GTCTC 1 cut(s) 314
BstMBI GATC 2 cut(s) 79, 297
BstNSI RCATGY 2 cut(s) 60, 264
BtgI CCRYGG 1 cut(s) 10
BtsI GCAGTG 1 cut(s) 137
BtsIMutI CAGTG 1 cut(s) 137
Cac8I GCNNGC 2 cut(s) 151, 262
CciI TCATGA 1 cut(s) 204
CviAII CATG 4 cut(s) 57, 205, 261, 272
CviJI RGCY 1 cut(s) 45
CviKI_1 RGCY 1 cut(s) 45
DdeI CTNAG 1 cut(s) 184
DpnI GATC 2 cut(s) 81, 299
DpnII GATC 2 cut(s) 79, 297
Eco130I CCWWGG 1 cut(s) 40
Eco31I GGTCTC 1 cut(s) 314
EcoT14I CCWWGG 1 cut(s) 40
EcoT22I ATGCAT 1 cut(s) 262
ErhI CCWWGG 1 cut(s) 40
FaeI CATG 4 cut(s) 60, 208, 264, 275
FaiI YATR 8 cut(s) 58, 107, 147, 164, 168, 206, 262, 273
FatI CATG 4 cut(s) 56, 204, 260, 271
FbaI TGATCA 1 cut(s) 79
FspBI CTAG 4 cut(s) 5, 74, 155, 316
Hin1II CATG 4 cut(s) 60, 208, 264, 275
HinfI GANTC 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 302
Hpy188III TCNNGA 3 cut(s) 23, 65, 205
Hpy8I GTNNAC 1 cut(s) 10
HpyAV CCTTC 2 cut(s) 46, 202
HpyCH4V TGCA 3 cut(s) 142, 260, 264
HpyF3I CTNAG 1 cut(s) 184
Hsp92II CATG 4 cut(s) 60, 208, 264, 275
Ksp22I TGATCA 1 cut(s) 79
Kzo9I GATC 2 cut(s) 79, 297
LmnI GCTCC 1 cut(s) 245
LpnPI CCDG 2 cut(s) 162, 163
LweI GCATC 1 cut(s) 276
MaeI CTAG 4 cut(s) 5, 74, 155, 316
MaeIII GTNAC 2 cut(s) 31, 62
MalI GATC 2 cut(s) 81, 299
MboI GATC 2 cut(s) 79, 297
MboII GAAGA 2 cut(s) 200, 295
MluCI AATT 2 cut(s) 199, 267
MnlI CCTC 3 cut(s) 30, 141, 288
Mph1103I ATGCAT 1 cut(s) 262
MseI TTAA 2 cut(s) 255, 291
MslI CAYNNNNRTG 1 cut(s) 276
MspCI CTTAAG 1 cut(s) 290
NdeII GATC 2 cut(s) 79, 297
NlaIII CATG 4 cut(s) 60, 208, 264, 275
NmuCI GTSAC 1 cut(s) 62
NsiI ATGCAT 1 cut(s) 262
NspI RCATGY 2 cut(s) 60, 264
PaeI GCATGC 1 cut(s) 264
PagI TCATGA 1 cut(s) 204
PfeI GAWTC 1 cut(s) 16
RseI CAYNNNNRTG 1 cut(s) 276
SaqAI TTAA 2 cut(s) 255, 291
Sau3AI GATC 2 cut(s) 79, 297
SetI ASST 1 cut(s) 38
SfaNI GCATC 1 cut(s) 276
SmiMI CAYNNNNRTG 1 cut(s) 276
SmlI CTYRAG 1 cut(s) 290
SmoI CTYRAG 1 cut(s) 290
SphI GCATGC 1 cut(s) 264
Sse9I AATT 2 cut(s) 199, 267
SspMI CTAG 4 cut(s) 5, 74, 155, 316
StyI CCWWGG 1 cut(s) 40
TaqI TCGA 1 cut(s) 172
TasI AATT 2 cut(s) 199, 267
TfiI GAWTC 1 cut(s) 16
Tru1I TTAA 2 cut(s) 255, 291
Tru9I TTAA 2 cut(s) 255, 291
TscAI CASTG 1 cut(s) 144
TseFI GTSAC 1 cut(s) 62
Tsp45I GTSAC 1 cut(s) 62
TspDTI ATGAA 4 cut(s) 122, 193, 221, 260
TspRI CASTG 1 cut(s) 144
Vha464I CTTAAG 1 cut(s) 290
XapI RAATTY 2 cut(s) 199, 267
XceI RCATGY 2 cut(s) 60, 264
XspI CTAG 4 cut(s) 5, 74, 155, 316
Zsp2I ATGCAT 1 cut(s) 262
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.