MD08G1183700.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0001357
Physical Location & Seq
Forward (+)
22884150 .. 22885030
881 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1183700.v1.1.491

Sequence Viewer

Length: 186 bp
ATGGGGCATATTGCTCTTGAATGCTACCATCGAAATAATTTCACTTACCAAGGAAGTCCACCACCACCATCTCTAACTACAATGATTGCACATGCTCATATTGGTCAAGGTCCACCACAGTACAATGGACATGGTTTTTCTAATGGTGATGCATGGATCTTAGACATAGTGCTACACACCATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.7

Weight (kDa)

6.24

Isoelectric Point (pI)

49.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 164
AfaI GTAC 1 cut(s) 122
AgsI TTSAA 1 cut(s) 20
AlwI GGATC 1 cut(s) 164
AspS9I GGNCC 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 158
AvaII GGWCC 1 cut(s) 110
BccI CCATC 2 cut(s) 36, 76
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 110
BmsI GCATC 1 cut(s) 139
BsaJI CCNNGG 1 cut(s) 49
BseDI CCNNGG 1 cut(s) 49
BsmI GAATGC 1 cut(s) 26
Bsp143I GATC 1 cut(s) 156
BspPI GGATC 1 cut(s) 164
BssECI CCNNGG 1 cut(s) 49
BssMI GATC 1 cut(s) 156
BssT1I CCWWGG 1 cut(s) 49
Bst4CI ACNGT 1 cut(s) 120
BstDEI CTNAG 1 cut(s) 160
BstKTI GATC 1 cut(s) 159
BstMBI GATC 1 cut(s) 156
BstNSI RCATGY 1 cut(s) 95
BstX2I RGATCY 1 cut(s) 156
BstYI RGATCY 1 cut(s) 156
Cfr13I GGNCC 1 cut(s) 110
Csp6I GTAC 1 cut(s) 121
CviAII CATG 3 cut(s) 92, 131, 153
CviQI GTAC 1 cut(s) 121
DdeI CTNAG 1 cut(s) 160
DpnI GATC 1 cut(s) 158
DpnII GATC 1 cut(s) 156
Eco130I CCWWGG 1 cut(s) 49
Eco47I GGWCC 1 cut(s) 110
EcoT14I CCWWGG 1 cut(s) 49
EcoT22I ATGCAT 1 cut(s) 154
ErhI CCWWGG 1 cut(s) 49
FaeI CATG 3 cut(s) 95, 134, 156
FaiI YATR 8 cut(s) 9, 93, 99, 132, 154, 167, 182, 184
FatI CATG 3 cut(s) 91, 130, 152
FauNDI CATATG 1 cut(s) 182
Hin1II CATG 3 cut(s) 95, 134, 156
HphI GGTGA 1 cut(s) 158
Hpy166II GTNNAC 2 cut(s) 59, 113
Hpy188III TCNNGA 1 cut(s) 17
Hpy8I GTNNAC 2 cut(s) 59, 113
HpyCH4III ACNGT 1 cut(s) 120
HpyCH4V TGCA 2 cut(s) 89, 152
HpyF3I CTNAG 1 cut(s) 160
Hsp92II CATG 3 cut(s) 95, 134, 156
Kzo9I GATC 1 cut(s) 156
LweI GCATC 1 cut(s) 139
MalI GATC 1 cut(s) 158
MboI GATC 1 cut(s) 156
MflI RGATCY 1 cut(s) 156
MluCI AATT 1 cut(s) 37
Mph1103I ATGCAT 1 cut(s) 154
Mva1269I GAATGC 1 cut(s) 26
NdeI CATATG 1 cut(s) 182
NdeII GATC 1 cut(s) 156
NlaIII CATG 3 cut(s) 95, 134, 156
NsiI ATGCAT 1 cut(s) 154
NspI RCATGY 1 cut(s) 95
PctI GAATGC 1 cut(s) 26
PspPI GGNCC 1 cut(s) 110
PsuI RGATCY 1 cut(s) 156
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
Sau3AI GATC 1 cut(s) 156
Sau96I GGNCC 1 cut(s) 110
SetI ASST 1 cut(s) 112
SfaNI GCATC 1 cut(s) 139
SgeI CNNG 6 cut(s) 29, 62, 104, 119, 143, 165
SinI GGWCC 1 cut(s) 110
Sse9I AATT 1 cut(s) 37
StyI CCWWGG 1 cut(s) 49
TaaI ACNGT 1 cut(s) 120
TaqI TCGA 1 cut(s) 31
TasI AATT 1 cut(s) 37
TatI WGTACW 1 cut(s) 120
VpaK11BI GGWCC 1 cut(s) 110
XceI RCATGY 1 cut(s) 95
Zsp2I ATGCAT 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.