RchiOBHm_Chr2g0137981

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001357
Physical Location & Seq
Forward (+)
55783194 .. 55783762
569 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50869

Sequence Viewer

Length: 162 bp
ATGATCCTCAGTGGCTTATTGCACTGGATTTCTGGAGGACAACCGGATTCTATTTCTGCTCCACCTGGCACTTTGTTGTCATTAGTAATGAAGATCAGCTGCAAGTGCTTTTACCTTGTCCTGAAAATTCAAATGAGCGTCCTGATTATATTCATTCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.79

Weight (kDa)

8.8

Isoelectric Point (pI)

46.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 126
AgsI TTSAA 1 cut(s) 131
AjnI CCWGG 1 cut(s) 64
AluBI AGCT 1 cut(s) 99
AluI AGCT 1 cut(s) 99
ApeKI GCWGC 1 cut(s) 99
ApoI RAATTY 1 cut(s) 126
BbvI GCAGC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 66
BisI GCNGC 1 cut(s) 100
BlsI GCNGC 1 cut(s) 101
Bme1390I CCNGG 1 cut(s) 66
BmrFI CCNGG 1 cut(s) 66
BpmI CTGGAG 1 cut(s) 54
BsaWI WCCGGW 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 29
BseBI CCWGG 1 cut(s) 66
BseMII CTCAG 1 cut(s) 22
BseNI ACTGG 1 cut(s) 29
BseXI GCAGC 1 cut(s) 86
BsiSI CCGG 1 cut(s) 44
Bsp143I GATC 2 cut(s) 3, 93
BspCNI CTCAG 1 cut(s) 21
BsrI ACTGG 1 cut(s) 29
BssMI GATC 2 cut(s) 3, 93
Bst2UI CCWGG 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 8
BstKTI GATC 2 cut(s) 6, 96
BstMBI GATC 2 cut(s) 3, 93
BstMWI GCNNNNNNNGC 1 cut(s) 105
BstNI CCWGG 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 64
BstV1I GCAGC 1 cut(s) 86
BtsIMutI CAGTG 2 cut(s) 16, 22
CseI GACGC 1 cut(s) 127
CviJI RGCY 2 cut(s) 15, 99
CviKI_1 RGCY 2 cut(s) 15, 99
DdeI CTNAG 1 cut(s) 8
DpnI GATC 2 cut(s) 5, 95
DpnII GATC 2 cut(s) 3, 93
EcoRII CCWGG 1 cut(s) 64
FaiI YATR 2 cut(s) 149, 160
Fnu4HI GCNGC 1 cut(s) 100
Fsp4HI GCNGC 1 cut(s) 100
GluI GCNGC 1 cut(s) 100
GsuI CTGGAG 1 cut(s) 54
HapII CCGG 1 cut(s) 44
HgaI GACGC 1 cut(s) 127
HinfI GANTC 1 cut(s) 47
HpaII CCGG 1 cut(s) 44
Hpy188III TCNNGA 3 cut(s) 33, 121, 142
HpyCH4V TGCA 2 cut(s) 22, 102
HpyF10VI GCNNNNNNNGC 1 cut(s) 105
HpyF3I CTNAG 1 cut(s) 8
Kzo9I GATC 2 cut(s) 3, 93
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 7 cut(s) 10, 18, 51, 57, 78, 134, 155
Lsp1109I GCAGC 1 cut(s) 86
MalI GATC 2 cut(s) 5, 95
MboI GATC 2 cut(s) 3, 93
MboII GAAGA 1 cut(s) 103
MluCI AATT 1 cut(s) 126
MnlI CCTC 2 cut(s) 17, 29
MspA1I CMGCKG 1 cut(s) 99
MspI CCGG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 66
MvaI CCWGG 1 cut(s) 66
MwoI GCNNNNNNNGC 1 cut(s) 105
NdeII GATC 2 cut(s) 3, 93
PfeI GAWTC 1 cut(s) 47
PkrI GCNGC 1 cut(s) 101
Psp6I CCWGG 1 cut(s) 64
PspGI CCWGG 1 cut(s) 64
PvuII CAGCTG 1 cut(s) 99
SatI GCNGC 1 cut(s) 100
Sau3AI GATC 2 cut(s) 3, 93
ScrFI CCNGG 1 cut(s) 66
SetI ASST 3 cut(s) 67, 101, 117
SgeI CNNG 9 cut(s) 37, 45, 56, 77, 78, 115, 128, 133, 154
Sse9I AATT 1 cut(s) 126
StyD4I CCNGG 1 cut(s) 64
TasI AATT 1 cut(s) 126
TfiI GAWTC 1 cut(s) 47
TscAI CASTG 2 cut(s) 16, 29
TseI GCWGC 1 cut(s) 99
TspDTI ATGAA 2 cut(s) 104, 142
TspRI CASTG 2 cut(s) 16, 29
XapI RAATTY 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.