pycom15g20870
RLK Family

cysteine-rich RLK (RECEPTOR-like protein kinase) 8

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0001357
Physical Location & Seq
Reverse (-)
14967152 .. 14968057
906 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g20870.2

Sequence Viewer

Length: 789 bp
ATGAGAGTCCTCCAATATTGTAGGTCGGAAAGACCTCCAGGAAATAATTACAATGATAATAATGGGAACAACTATAATGGCAATTTTGGTGGCAATAGAAATTTTGGGGGTTTTAATGGTCCAAGGAACAACTATAGACCTCGAAATAATGGAAGTTATAATGGTGGTAATCGAAACAATGGATGGTTTTTTGGTTCCTCAGGTAGTTATCAATCTAAGAATGGTTCATTTGGTGGAGGTTCATCTGGGAATTCTTGGTCTAATTGGAATGGCAATACTGGTCAGAAGTCTAATATCATACCTGAGTGTCAAATTTGTAGTAAATGTGGACATACTGCACCAAACTGTTTTTACATAAATGAGCAACAACCTATCTCTGGTGGTTCTATTCCAAAGTGTCAAATTTATGGAAAACAGGGTCACATAGCACTCAATTGTTATCACATAAGTAACTATGTGTTTCAAGATGCTAATCCACCTCCATCACTCATTGCAATGGATGCAAGTGCATCTTCTGAATTCAATGCTAATCAAGCATGGATCATGAACATAGGTGCTATACACCATGTGACAGGAGATATGGTAGACTTAAACATAGTTACACCTTTTGAGGAAGATCAAAAAATCATAGTGGGAAATGGAGAGTGTCTTCTAGTGAAAAATAATGGTTCAAATTCTATTTCCACTACTTCTAAACCATTGCATTTGTTAACTATCTCACATGTTCCTCATTTAACTGCAAGTTTATTGTCAGTTTATCCATATGCAAAGACAATAATTGTTATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2 Retrotran_gag_3 Retrotrans_gag gag_pre-integrs rve

Protein Analysis

263

Amino Acids

28.51

Weight (kDa)

8.59

Isoelectric Point (pI)

33.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 159
AccI GTMKAC 1 cut(s) 585
AclWI GGATC 1 cut(s) 548
AcsI RAATTY 6 cut(s) 100, 250, 312, 402, 518, 673
AdeI CACNNNGTG 1 cut(s) 568
AfiI CCNNNNNNNGG 1 cut(s) 377
AflIII ACRYGT 1 cut(s) 721
AgsI TTSAA 3 cut(s) 464, 523, 672
AjnI CCWGG 1 cut(s) 37
AlwI GGATC 1 cut(s) 548
ApoI RAATTY 6 cut(s) 100, 250, 312, 402, 518, 673
AspS9I GGNCC 1 cut(s) 119
AvaII GGWCC 1 cut(s) 119
AxyI CCTNAGG 1 cut(s) 199
BbsI GAAGAC 1 cut(s) 641
BccI CCATC 2 cut(s) 177, 490
BciT130I CCWGG 1 cut(s) 39
BfaI CTAG 1 cut(s) 653
BfmI CTRYAG 1 cut(s) 133
Bme1390I CCNGG 1 cut(s) 39
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 196
BmrFI CCNGG 1 cut(s) 39
BmsI GCATC 3 cut(s) 457, 490, 518
BpiI GAAGAC 1 cut(s) 641
BpmI CTGGAG 1 cut(s) 21
BsaBI GATNNNNATC 1 cut(s) 471
BsaJI CCNNGG 1 cut(s) 122
BsaXI ACNNNNNCTCC 2 cut(s) 567, 597
Bsc4I CCNNNNNNNGG 1 cut(s) 377
Bse1I ACTGG 1 cut(s) 283
Bse21I CCTNAGG 1 cut(s) 199
Bse3DI GCAATG 3 cut(s) 489, 501, 698
Bse8I GATNNNNATC 1 cut(s) 471
BseBI CCWGG 1 cut(s) 39
BseDI CCNNGG 1 cut(s) 122
BseGI GGATG 2 cut(s) 188, 505
BseJI GATNNNNATC 1 cut(s) 471
BseLI CCNNNNNNNGG 1 cut(s) 377
BseMI GCAATG 3 cut(s) 489, 501, 698
BseMII CTCAG 2 cut(s) 213, 294
BseNI ACTGG 1 cut(s) 283
BsgI GTGCAG 1 cut(s) 321
BslI CCNNNNNNNGG 1 cut(s) 377
Bsp143I GATC 2 cut(s) 540, 616
BspCNI CTCAG 2 cut(s) 212, 295
BspHI TCATGA 1 cut(s) 543
BspLI GGNNCC 1 cut(s) 196
BspPI GGATC 1 cut(s) 548
BsrDI GCAATG 3 cut(s) 489, 501, 698
BsrI ACTGG 1 cut(s) 283
BssECI CCNNGG 1 cut(s) 122
BssMI GATC 2 cut(s) 540, 616
BssT1I CCWWGG 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 39
Bst4CI ACNGT 1 cut(s) 347
BstAPI GCANNNNNTGC 1 cut(s) 500
BstDEI CTNAG 3 cut(s) 199, 216, 303
BstF5I GGATG 2 cut(s) 188, 505
BstKTI GATC 2 cut(s) 543, 619
BstMBI GATC 2 cut(s) 540, 616
BstMWI GCNNNNNNNGC 2 cut(s) 500, 533
BstNI CCWGG 1 cut(s) 39
BstNSI RCATGY 1 cut(s) 725
BstSCI CCNGG 1 cut(s) 37
BstSFI CTRYAG 1 cut(s) 133
BstV2I GAAGAC 1 cut(s) 641
Bsu36I CCTNAGG 1 cut(s) 199
BtsCI GGATG 2 cut(s) 188, 505
CciI TCATGA 1 cut(s) 543
Cfr13I GGNCC 1 cut(s) 119
CspCI CAANNNNNGTGG 2 cut(s) 70, 105
CviAII CATG 4 cut(s) 537, 544, 566, 722
DdeI CTNAG 3 cut(s) 199, 216, 303
DpnI GATC 2 cut(s) 542, 618
DpnII GATC 2 cut(s) 540, 616
DraIII CACNNNGTG 1 cut(s) 568
Eco130I CCWWGG 1 cut(s) 122
Eco47I GGWCC 1 cut(s) 119
Eco81I CCTNAGG 1 cut(s) 199
EcoRI GAATTC 2 cut(s) 250, 518
EcoRII CCWGG 1 cut(s) 37
EcoT14I CCWWGG 1 cut(s) 122
ErhI CCWWGG 1 cut(s) 122
FaeI CATG 4 cut(s) 540, 547, 569, 725
FalI AAGNNNNNCTT 2 cut(s) 496, 528
FatI CATG 4 cut(s) 536, 543, 565, 721
FauNDI CATATG 1 cut(s) 763
FblI GTMKAC 1 cut(s) 585
FokI GGATG 2 cut(s) 195, 512
FspBI CTAG 1 cut(s) 653
GsuI CTGGAG 1 cut(s) 21
Hin1II CATG 4 cut(s) 540, 547, 569, 725
HincII GTYRAC 1 cut(s) 711
HindII GTYRAC 1 cut(s) 711
HinfI GANTC 1 cut(s) 6
HpaI GTTAAC 1 cut(s) 711
Hpy166II GTNNAC 3 cut(s) 329, 586, 711
Hpy188I TCNGA 3 cut(s) 28, 285, 517
Hpy188III TCNNGA 2 cut(s) 464, 544
Hpy8I GTNNAC 3 cut(s) 329, 586, 711
HpyCH4III ACNGT 1 cut(s) 347
HpyCH4V TGCA 7 cut(s) 338, 494, 503, 509, 703, 740, 767
HpyF10VI GCNNNNNNNGC 2 cut(s) 500, 533
HpyF3I CTNAG 3 cut(s) 199, 216, 303
Hsp92II CATG 4 cut(s) 540, 547, 569, 725
KspAI GTTAAC 1 cut(s) 711
Kzo9I GATC 2 cut(s) 540, 616
LpnPI CCDG 9 cut(s) 24, 51, 186, 231, 264, 315, 363, 401, 558
LweI GCATC 3 cut(s) 457, 490, 518
MaeI CTAG 1 cut(s) 653
MaeIII GTNAC 4 cut(s) 419, 449, 568, 598
MalI GATC 2 cut(s) 542, 618
MboI GATC 2 cut(s) 540, 616
MboII GAAGA 3 cut(s) 504, 626, 641
MfeI CAATTG 1 cut(s) 433
MlyI GAGTC 1 cut(s) 15
MmeI TCCRAC 1 cut(s) 6
MnlI CCTC 8 cut(s) 20, 45, 150, 208, 230, 489, 604, 738
MseI TTAA 4 cut(s) 114, 590, 710, 734
MslI CAYNNNNRTG 1 cut(s) 494
MspR9I CCNGG 1 cut(s) 39
MunI CAATTG 1 cut(s) 433
MvaI CCWGG 1 cut(s) 39
MwoI GCNNNNNNNGC 2 cut(s) 500, 533
NdeI CATATG 1 cut(s) 763
NdeII GATC 2 cut(s) 540, 616
NlaIII CATG 4 cut(s) 540, 547, 569, 725
NlaIV GGNNCC 1 cut(s) 196
NmuCI GTSAC 2 cut(s) 419, 568
NspI RCATGY 1 cut(s) 725
PagI TCATGA 1 cut(s) 543
PciI ACATGT 1 cut(s) 721
PfoI TCCNGGA 1 cut(s) 37
PleI GAGTC 1 cut(s) 14
PpsI GAGTC 1 cut(s) 14
PscI ACATGT 1 cut(s) 721
PsiI TTATAA 1 cut(s) 159
Psp6I CCWGG 1 cut(s) 37
PspGI CCWGG 1 cut(s) 37
PspN4I GGNNCC 1 cut(s) 196
PspPI GGNCC 1 cut(s) 119
RseI CAYNNNNRTG 1 cut(s) 494
SaqAI TTAA 4 cut(s) 114, 590, 710, 734
Sau3AI GATC 2 cut(s) 540, 616
Sau96I GGNCC 1 cut(s) 119
SchI GAGTC 1 cut(s) 15
ScrFI CCNGG 1 cut(s) 39
SfaNI GCATC 3 cut(s) 457, 490, 518
SfcI CTRYAG 1 cut(s) 133
SinI GGWCC 1 cut(s) 119
SmiMI CAYNNNNRTG 1 cut(s) 494
SspI AATATT 1 cut(s) 17
SspMI CTAG 1 cut(s) 653
StyD4I CCNGG 1 cut(s) 37
StyI CCWWGG 1 cut(s) 122
TaaI ACNGT 1 cut(s) 347
TaqI TCGA 2 cut(s) 142, 172
Tru1I TTAA 4 cut(s) 114, 590, 710, 734
Tru9I TTAA 4 cut(s) 114, 590, 710, 734
TseFI GTSAC 2 cut(s) 419, 568
Tsp45I GTSAC 2 cut(s) 419, 568
TspDTI ATGAA 3 cut(s) 216, 231, 560
VpaK11BI GGWCC 1 cut(s) 119
XapI RAATTY 6 cut(s) 100, 250, 312, 402, 518, 673
XceI RCATGY 1 cut(s) 725
XmiI GTMKAC 1 cut(s) 585
XspI CTAG 1 cut(s) 653
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.