MD09G1228400.v1.1
RLK Family

Cysteine-rich RLK (RECEPTOR-like protein kinase) 8

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0001357
Physical Location & Seq
Reverse (-)
28184230 .. 28186057
1828 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1228400.v1.1.491

Sequence Viewer

Length: 864 bp
ATGGGTGTTGAAGCTGCACTTGAAACAAAGATGAATACTCTTACTGGAACAATGTCAGCAATGTATATGAATGGTGAATTGTCAAATGCAAGAGGACCTCAAGGTAGTTTTCAGAATTTCAAGCAAGGAGAAAGTTCTAATTCACAAAGATATCAAGGAGGTTTTAATGGTGGTTCTGGTTTTGCTGGGAATGGAGGTAGATCTTTTCAACAGAGATCTGGTTTTAATAATAACAGAAGGTTTAATGGAAATAACAACAGCAGCAATTCAAGATCTTATTCCAACTTTGGTAACAAATCTTATGGCTCTAATGGTTTGACTGATAACAACAAGGGATCTCAGAATTACTATAGTGGTTCAAACAACTTTTCTGGTGAAAATGGTTTCAAGCAAGGAAGTGGATGGACTGGTAACACAAACTACAAGTCTGCTGTGTCTCCAGAGTGTCAAATATGTTCTAGAAGAGGGCATACTGCACCAAATTGTTACTACAGGACTGATAATGGTCAAGCTAATCCTAGAGGGCCAATCTTTTGTCAAATCTGTGGCAAGAAAGGTCACACTGCACTCCAATGCTATCACAGGAACAACTACTCGTATCAAGGACCTCCTCCACCTCAAACCTTGACTCAATCACCTATGGGAATGTCTGCTCAGACTTCAACTACAATGCAAGAGGCTCAAAGTGTCCATGGGTTTTCAAATGCAGATACATGGGTGGTGGACACAGGTGCAACTCATCACATGACAGCCAATCTTGATCACATCAATCATGTCACTCCTTATAATGGTGAAGCTAAAATCACTATAGGCAATGGAGCAGGACAAGGCAACTCAGGTGATTCTGTACCAAGGAAAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2 gag_pre-integrs rve

Protein Analysis

288

Amino Acids

30.84

Weight (kDa)

9.22

Isoelectric Point (pI)

31.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 786
AclWI GGATC 1 cut(s) 343
AcsI RAATTY 1 cut(s) 115
AfaI GTAC 1 cut(s) 849
AfiI CCNNNNNNNGG 1 cut(s) 788
AgsI TTSAA 9 cut(s) 11, 23, 121, 209, 270, 360, 388, 663, 702
AluBI AGCT 3 cut(s) 14, 512, 797
AluI AGCT 3 cut(s) 14, 512, 797
Alw26I GTCTC 1 cut(s) 441
AlwI GGATC 1 cut(s) 343
AoxI GGCC 1 cut(s) 524
ApeKI GCWGC 2 cut(s) 14, 261
ApoI RAATTY 1 cut(s) 115
ArsI GACNNNNNNTTYG 2 cut(s) 410, 442
AspS9I GGNCC 3 cut(s) 95, 524, 605
AsuHPI GGTGA 5 cut(s) 86, 386, 627, 803, 851
AvaII GGWCC 2 cut(s) 95, 605
BaeI ACNNNNGTAYC 2 cut(s) 702, 735
BarI GAAGNNNNNNTAC 2 cut(s) 454, 486
BbvI GCAGC 1 cut(s) 273
BccI CCATC 1 cut(s) 396
BclI TGATCA 1 cut(s) 760
BcoDI GTCTC 1 cut(s) 441
BfaI CTAG 2 cut(s) 459, 519
BfmI CTRYAG 3 cut(s) 349, 490, 807
BglII AGATCT 3 cut(s) 200, 215, 272
BisI GCNGC 2 cut(s) 15, 262
BlsI GCNGC 2 cut(s) 16, 263
Bme18I GGWCC 2 cut(s) 95, 605
BmgT120I GGNCC 3 cut(s) 95, 524, 605
BpmI CTGGAG 1 cut(s) 423
BpuEI CTTGAG 1 cut(s) 84
BsaJI CCNNGG 2 cut(s) 691, 851
Bsc4I CCNNNNNNNGG 1 cut(s) 788
Bse1I ACTGG 2 cut(s) 49, 412
Bse3DI GCAATG 2 cut(s) 66, 820
BseDI CCNNGG 2 cut(s) 691, 851
BseGI GGATG 1 cut(s) 407
BseLI CCNNNNNNNGG 1 cut(s) 788
BseMI GCAATG 2 cut(s) 66, 820
BseMII CTCAG 3 cut(s) 353, 668, 849
BseNI ACTGG 2 cut(s) 49, 412
BseRI GAGGAG 1 cut(s) 600
BseXI GCAGC 1 cut(s) 273
BseYI CCCAGC 1 cut(s) 185
BsgI GTGCAG 2 cut(s) 459, 549
BshFI GGCC 1 cut(s) 526
BslI CCNNNNNNNGG 1 cut(s) 788
BsmAI GTCTC 1 cut(s) 441
BsnI GGCC 1 cut(s) 526
Bsp143I GATC 5 cut(s) 200, 215, 272, 335, 760
Bsp19I CCATGG 1 cut(s) 691
BspANI GGCC 1 cut(s) 526
BspCNI CTCAG 3 cut(s) 352, 667, 848
BspPI GGATC 1 cut(s) 343
BsrDI GCAATG 2 cut(s) 66, 820
BsrI ACTGG 2 cut(s) 49, 412
BssECI CCNNGG 2 cut(s) 691, 851
BssMI GATC 5 cut(s) 200, 215, 272, 335, 760
BssT1I CCWWGG 2 cut(s) 691, 851
Bst6I CTCTTC 1 cut(s) 457
BstDEI CTNAG 3 cut(s) 339, 654, 835
BstDSI CCRYGG 1 cut(s) 691
BstF5I GGATG 1 cut(s) 407
BstKTI GATC 5 cut(s) 203, 218, 275, 338, 763
BstMAI GTCTC 1 cut(s) 441
BstMBI GATC 5 cut(s) 200, 215, 272, 335, 760
BstSFI CTRYAG 3 cut(s) 349, 490, 807
BstV1I GCAGC 1 cut(s) 273
BstX2I RGATCY 4 cut(s) 200, 215, 272, 335
BstYI RGATCY 4 cut(s) 200, 215, 272, 335
BsuRI GGCC 1 cut(s) 526
BtgI CCRYGG 1 cut(s) 691
BtsCI GGATG 1 cut(s) 407
BtsI GCAGTG 1 cut(s) 561
BtsIMutI CAGTG 1 cut(s) 561
Cfr13I GGNCC 3 cut(s) 95, 524, 605
Csp6I GTAC 1 cut(s) 848
CviAII CATG 4 cut(s) 692, 714, 745, 773
CviJI RGCY 7 cut(s) 14, 306, 512, 526, 680, 752, 797
CviKI_1 RGCY 7 cut(s) 14, 306, 512, 526, 680, 752, 797
CviQI GTAC 1 cut(s) 848
DdeI CTNAG 3 cut(s) 339, 654, 835
DpnI GATC 5 cut(s) 202, 217, 274, 337, 762
DpnII GATC 5 cut(s) 200, 215, 272, 335, 760
Eam1104I CTCTTC 1 cut(s) 457
EarI CTCTTC 1 cut(s) 457
Eco130I CCWWGG 2 cut(s) 691, 851
Eco32I GATATC 1 cut(s) 152
Eco47I GGWCC 2 cut(s) 95, 605
EcoO109I RGGNCCY 2 cut(s) 95, 605
EcoRV GATATC 1 cut(s) 152
EcoT14I CCWWGG 2 cut(s) 691, 851
ErhI CCWWGG 2 cut(s) 691, 851
FaeI CATG 4 cut(s) 695, 717, 748, 776
FalI AAGNNNNNCTT 1 cut(s) 35
FatI CATG 4 cut(s) 691, 713, 744, 772
FbaI TGATCA 1 cut(s) 760
Fnu4HI GCNGC 2 cut(s) 15, 262
FokI GGATG 1 cut(s) 414
Fsp4HI GCNGC 2 cut(s) 15, 262
FspBI CTAG 2 cut(s) 459, 519
GluI GCNGC 2 cut(s) 15, 262
GsaI CCCAGC 1 cut(s) 189
GsuI CTGGAG 1 cut(s) 423
HaeIII GGCC 1 cut(s) 526
Hin1II CATG 4 cut(s) 695, 717, 748, 776
HinfI GANTC 2 cut(s) 628, 842
HphI GGTGA 5 cut(s) 86, 386, 627, 803, 851
Hpy166II GTNNAC 1 cut(s) 724
Hpy188I TCNGA 3 cut(s) 114, 342, 657
Hpy188III TCNNGA 4 cut(s) 270, 440, 459, 758
Hpy8I GTNNAC 1 cut(s) 724
HpyAV CCTTC 1 cut(s) 231
HpyCH4V TGCA 7 cut(s) 17, 89, 476, 566, 673, 707, 734
HpyF3I CTNAG 3 cut(s) 339, 654, 835
Hsp92II CATG 4 cut(s) 695, 717, 748, 776
Ksp22I TGATCA 1 cut(s) 760
Kzo9I GATC 5 cut(s) 200, 215, 272, 335, 760
LmnI GCTCC 1 cut(s) 818
Lsp1109I GCAGC 1 cut(s) 273
MaeI CTAG 2 cut(s) 459, 519
MaeIII GTNAC 5 cut(s) 290, 410, 485, 557, 775
MalI GATC 5 cut(s) 202, 217, 274, 337, 762
MboI GATC 5 cut(s) 200, 215, 272, 335, 760
MboII GAAGA 1 cut(s) 474
MflI RGATCY 4 cut(s) 200, 215, 272, 335
MluCI AATT 6 cut(s) 77, 115, 139, 265, 343, 481
MlyI GAGTC 1 cut(s) 622
MmeI TCCRAC 1 cut(s) 306
MseI TTAA 3 cut(s) 165, 225, 243
MslI CAYNNNNRTG 1 cut(s) 571
NcoI CCATGG 1 cut(s) 691
NdeII GATC 5 cut(s) 200, 215, 272, 335, 760
NlaIII CATG 4 cut(s) 695, 717, 748, 776
NmuCI GTSAC 2 cut(s) 557, 775
PfeI GAWTC 1 cut(s) 842
PkrI GCNGC 2 cut(s) 16, 263
PleI GAGTC 1 cut(s) 622
PpsI GAGTC 1 cut(s) 622
PpuMI RGGWCCY 2 cut(s) 95, 605
PsiI TTATAA 1 cut(s) 786
Psp5II RGGWCCY 2 cut(s) 95, 605
PspFI CCCAGC 1 cut(s) 185
PspPI GGNCC 3 cut(s) 95, 524, 605
PspPPI RGGWCCY 2 cut(s) 95, 605
PsuI RGATCY 4 cut(s) 200, 215, 272, 335
RsaI GTAC 1 cut(s) 849
RsaNI GTAC 1 cut(s) 848
RseI CAYNNNNRTG 1 cut(s) 571
SaqAI TTAA 3 cut(s) 165, 225, 243
SatI GCNGC 2 cut(s) 15, 262
Sau3AI GATC 5 cut(s) 200, 215, 272, 335, 760
Sau96I GGNCC 3 cut(s) 95, 524, 605
SchI GAGTC 1 cut(s) 622
SfcI CTRYAG 3 cut(s) 349, 490, 807
SinI GGWCC 2 cut(s) 95, 605
SmiMI CAYNNNNRTG 1 cut(s) 571
SmlI CTYRAG 1 cut(s) 99
SmoI CTYRAG 1 cut(s) 99
Sse9I AATT 6 cut(s) 77, 115, 139, 265, 343, 481
SspMI CTAG 2 cut(s) 459, 519
StyI CCWWGG 2 cut(s) 691, 851
TasI AATT 6 cut(s) 77, 115, 139, 265, 343, 481
TfiI GAWTC 1 cut(s) 842
Tru1I TTAA 3 cut(s) 165, 225, 243
Tru9I TTAA 3 cut(s) 165, 225, 243
TscAI CASTG 1 cut(s) 568
TseFI GTSAC 2 cut(s) 557, 775
TseI GCWGC 2 cut(s) 14, 261
Tsp45I GTSAC 2 cut(s) 557, 775
TspDTI ATGAA 2 cut(s) 47, 83
TspRI CASTG 1 cut(s) 568
VpaK11BI GGWCC 2 cut(s) 95, 605
XapI RAATTY 1 cut(s) 115
XbaI TCTAGA 1 cut(s) 458
XspI CTAG 2 cut(s) 459, 519
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.