MD11G1151000.v1.1

Belongs to the glycosyl hydrolase 1 family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
14349265 .. 14349653
389 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1151000.v1.1.491

Sequence Viewer

Length: 162 bp
ATGTTGAGAGTTTCATTTTTTCTGTGTTTTCTTCTCGTAAAGCTTTCTTTATGCGCTGATAAATTTAGCAGAGATGACTTCCCTCCAGGCTTCGTGTTTGGTGCTTCCTCCTCTGCTTATCAGTGCTACGCATCAATAGGAAAGAAGAAGAGAAGAAACTGA

Protein Analysis

54

Amino Acids

6.02

Weight (kDa)

9.73

Isoelectric Point (pI)

43.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 62
AjnI CCWGG 1 cut(s) 85
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
ApoI RAATTY 1 cut(s) 62
AspLEI GCGC 1 cut(s) 56
BciT130I CCWGG 1 cut(s) 87
Bme1390I CCNGG 1 cut(s) 87
BmrFI CCNGG 1 cut(s) 87
BmsI GCATC 1 cut(s) 140
BpmI CTGGAG 1 cut(s) 69
BseBI CCWGG 1 cut(s) 87
BseRI GAGGAG 1 cut(s) 100
Bst2UI CCWGG 1 cut(s) 87
Bst6I CTCTTC 1 cut(s) 143
BstHHI GCGC 1 cut(s) 56
BstNI CCWGG 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 85
BtsIMutI CAGTG 1 cut(s) 128
CfoI GCGC 1 cut(s) 56
CviJI RGCY 2 cut(s) 43, 90
CviKI_1 RGCY 2 cut(s) 43, 90
Eam1104I CTCTTC 1 cut(s) 143
EarI CTCTTC 1 cut(s) 143
EcoRII CCWGG 1 cut(s) 85
FaiI YATR 1 cut(s) 52
FspEI CC 8 cut(s) 72, 84, 95, 96, 99, 121, 123, 124
GlaI GCGC 1 cut(s) 55
GsuI CTGGAG 1 cut(s) 69
HhaI GCGC 1 cut(s) 56
Hin6I GCGC 1 cut(s) 54
HinP1I GCGC 1 cut(s) 54
HindIII AAGCTT 1 cut(s) 41
HspAI GCGC 1 cut(s) 54
LpnPI CCDG 2 cut(s) 72, 99
LweI GCATC 1 cut(s) 140
MboII GAAGA 3 cut(s) 23, 157, 160
MluCI AATT 1 cut(s) 62
MnlI CCTC 3 cut(s) 93, 118, 121
MspR9I CCNGG 1 cut(s) 87
MvaI CCWGG 1 cut(s) 87
Psp6I CCWGG 1 cut(s) 85
PspGI CCWGG 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 87
SetI ASST 1 cut(s) 45
SfaNI GCATC 1 cut(s) 140
SgeI CNNG 4 cut(s) 47, 98, 99, 106
Sse9I AATT 1 cut(s) 62
StyD4I CCNGG 1 cut(s) 85
TasI AATT 1 cut(s) 62
TscAI CASTG 1 cut(s) 128
TspRI CASTG 1 cut(s) 128
XapI RAATTY 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.