Prupe.8G133200_v2.0.a1

High mobility group B protein

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
15486130 .. 15487301
1172 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G133200.1

Sequence Viewer

Length: 201 bp
ATGAAGGCTACTGAGAACCAGCCAGAGACTGAGAAAAATGGCTCTCAATGCCTTGGTACTATGAATTCCAATGTGATACTTTCTGAGCCTGATGATGGGAAAAGCTTGCTGGAGTTGGAGAACTCTGAGATTGAGAGTTTCTATCAGAGACTCAACAAGTTGCACAACTCGTCTGGGCTGAATCTTCTTTTTGATCTCTGA

Protein Analysis

67

Amino Acids

7.39

Weight (kDa)

4.44

Isoelectric Point (pI)

58.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 64
AfaI GTAC 1 cut(s) 58
AfiI CCNNNNNNNGG 1 cut(s) 95
AluBI AGCT 1 cut(s) 105
AluI AGCT 1 cut(s) 105
Alw26I GTCTC 2 cut(s) 20, 142
AlwNI CAGNNNCTG 1 cut(s) 29
ApoI RAATTY 1 cut(s) 64
BccI CCATC 1 cut(s) 89
BcoDI GTCTC 2 cut(s) 20, 142
BpmI CTGGAG 1 cut(s) 131
BsaJI CCNNGG 1 cut(s) 52
Bsc4I CCNNNNNNNGG 1 cut(s) 95
BseDI CCNNGG 1 cut(s) 52
BseLI CCNNNNNNNGG 1 cut(s) 95
BseMII CTCAG 3 cut(s) 21, 75, 117
BslI CCNNNNNNNGG 1 cut(s) 95
BsmAI GTCTC 2 cut(s) 20, 142
Bsp143I GATC 1 cut(s) 193
BspCNI CTCAG 4 cut(s) 4, 22, 76, 118
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 1 cut(s) 193
BssT1I CCWWGG 1 cut(s) 52
BstC8I GCNNGC 1 cut(s) 107
BstDEI CTNAG 4 cut(s) 12, 30, 84, 126
BstKTI GATC 1 cut(s) 196
BstMAI GTCTC 2 cut(s) 20, 142
BstMBI GATC 1 cut(s) 193
BstMWI GCNNNNNNNGC 1 cut(s) 48
Cac8I GCNNGC 1 cut(s) 107
CaiI CAGNNNCTG 1 cut(s) 29
Csp6I GTAC 1 cut(s) 57
CviJI RGCY 6 cut(s) 8, 22, 42, 88, 105, 178
CviKI_1 RGCY 6 cut(s) 8, 22, 42, 88, 105, 178
CviQI GTAC 1 cut(s) 57
DdeI CTNAG 4 cut(s) 12, 30, 84, 126
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
Eco130I CCWWGG 1 cut(s) 52
EcoRI GAATTC 1 cut(s) 64
EcoT14I CCWWGG 1 cut(s) 52
ErhI CCWWGG 1 cut(s) 52
FaiI YATR 1 cut(s) 62
GsuI CTGGAG 1 cut(s) 131
HindIII AAGCTT 1 cut(s) 103
HinfI GANTC 2 cut(s) 150, 181
Hpy188I TCNGA 4 cut(s) 85, 127, 147, 200
HpyCH4V TGCA 1 cut(s) 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
HpyF3I CTNAG 4 cut(s) 12, 30, 84, 126
Kzo9I GATC 1 cut(s) 193
LpnPI CCDG 5 cut(s) 32, 36, 95, 102, 159
MalI GATC 1 cut(s) 195
MboI GATC 1 cut(s) 193
MboII GAAGA 1 cut(s) 176
MluCI AATT 1 cut(s) 64
MlyI GAGTC 1 cut(s) 144
MmeI TCCRAC 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 48
NdeII GATC 1 cut(s) 193
PfeI GAWTC 1 cut(s) 181
PleI GAGTC 1 cut(s) 144
PpsI GAGTC 1 cut(s) 144
PstNI CAGNNNCTG 1 cut(s) 29
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
Sau3AI GATC 1 cut(s) 193
SchI GAGTC 1 cut(s) 144
SetI ASST 1 cut(s) 107
SgeI CNNG 9 cut(s) 31, 35, 65, 101, 118, 122, 169, 181, 186
Sse9I AATT 1 cut(s) 64
StyI CCWWGG 1 cut(s) 52
TasI AATT 1 cut(s) 64
TfiI GAWTC 1 cut(s) 181
TspDTI ATGAA 2 cut(s) 17, 77
XapI RAATTY 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.