Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000002

Orthogroup ID

OG0001197

Physical Location & Seq

Genomic Coordinates Reverse (-)

76337007 .. 76340392

Gene Structure 3386 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_2G00138210.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 174 bp

ATGATTGATCTCTGTCGAGTTGTTGGGTTGTGGGAGTTGTTTGAAGATCTCACTATTAATATTGAGGATAACCTACAAATGGAAATGAAGTGCACAAGCCATTCGTCTCAAATGGTAACAGATGTTGATGATGGGCCTGGAGAGAAGAAGATGCTCAAGGAGAGCTATTCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ARID

Protein Analysis

57

Amino Acids

6.55

Weight (kDa)

4.27

Isoelectric Point (pI)

55.02

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001197)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g07580 FvH4_6g07580 FvH4_6g07580 FvH4_6g07580 FvH4_6g07580 FvH4_6g07580 FvH4_6g07580 FvH4_6g07580 FvH4_6g07580 FvH4_6g07580
malus_domestica	MD04G1192900.v1.1 MD12G1204900.v1.1 MD12G1205000.v1.1
prunus_persica	Prupe.6G312100_v2.0.a1 Prupe.6G312100_v2.0.a1 Prupe.8G133200_v2.0.a1
pyrus_communis	pycom04g17020
rosa_chinensis	RchiOBHm_Chr2g0141791 RchiOBHm_Chr3g0457251 RchiOBHm_Chr4g0385001 RchiOBHm_Chr4g0403641 RchiOBHm_Chr7g0230301
rosa_laevigata	RLG00000025239 RLG00000028879
rosa_multiflora	Rmu_co8006356.1_g000001 Rmu_sc0001700.1_g000022 Rmu_sc0024999.1_g000001
rosa_roxburghii	Rroxscaffold_1G00021260 Rroxscaffold_2G00110110 Rroxscaffold_2G00138210 Rroxscaffold_5G00336070 Rroxscaffold_5G00364990 Rroxscaffold_5G00371660 Rroxscaffold_6G00422040 Rroxscaffold_6G00422070 Rroxscaffold_7G00210610
rosa_rugosa	Rorug03G0019600 Rorug04G0448000 Rorug07G0240100.1
rosa_samantha	Rh2AG158300 Rh2AG504600 Rh2CG490600 Rh2DG163500 Rh2DG673200 Rh3AG079500 Rh3BG081200 Rh3CG081600 Rh3CG370900 Rh3DG083200 Rh4DG031800 Rh4DG287000 Rh5DG474000 Rh7AG251600 Rh7AG400700 Rh7AG488300 Rh7CG268400
rosa_wichuraiana	Rw3G006850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfiI	CCNNNNNNNGG	1 cut(s)	79
AgsI	TTSAA	1 cut(s)	44
AjnI	CCWGG	1 cut(s)	136
AluBI	AGCT	1 cut(s)	165
AluI	AGCT	1 cut(s)	165
Alw21I	GWGCWC	1 cut(s)	95
Alw26I	GTCTC	1 cut(s)	111
Alw44I	GTGCAC	1 cut(s)	91
AoxI	GGCC	1 cut(s)	134
ApaLI	GTGCAC	1 cut(s)	91
AseI	ATTAAT	1 cut(s)	57
AspS9I	GGNCC	1 cut(s)	134
BaeGI	GKGCMC	1 cut(s)	95
Bbv12I	GWGCWC	1 cut(s)	95
BccI	CCATC	1 cut(s)	125
BciT130I	CCWGG	1 cut(s)	138
BcoDI	GTCTC	1 cut(s)	111
BglII	AGATCT	1 cut(s)	46
Bme1390I	CCNGG	1 cut(s)	138
BmgT120I	GGNCC	1 cut(s)	134
BmrFI	CCNGG	1 cut(s)	138
BmsI	GCATC	1 cut(s)	141
BpmI	CTGGAG	1 cut(s)	159
BpuEI	CTTGAG	1 cut(s)	140
Bsc4I	CCNNNNNNNGG	1 cut(s)	79
BseBI	CCWGG	1 cut(s)	138
BseLI	CCNNNNNNNGG	1 cut(s)	79
BseSI	GKGCMC	1 cut(s)	95
BshFI	GGCC	1 cut(s)	136
BsiHKAI	GWGCWC	1 cut(s)	95
BslI	CCNNNNNNNGG	1 cut(s)	79
BsmAI	GTCTC	1 cut(s)	111
BsmBI	CGTCTC	1 cut(s)	111
BsnI	GGCC	1 cut(s)	136
Bsp1286I	GDGCHC	1 cut(s)	95
Bsp143I	GATC	2 cut(s)	7, 46
BspANI	GGCC	1 cut(s)	136
BssMI	GATC	2 cut(s)	7, 46
Bst2UI	CCWGG	1 cut(s)	138
BstKTI	GATC	2 cut(s)	10, 49
BstMAI	GTCTC	1 cut(s)	111
BstMBI	GATC	2 cut(s)	7, 46
BstNI	CCWGG	1 cut(s)	138
BstSCI	CCNGG	1 cut(s)	136
BstSLI	GKGCMC	1 cut(s)	95
BstX2I	RGATCY	1 cut(s)	46
BstYI	RGATCY	1 cut(s)	46
BsuRI	GGCC	1 cut(s)	136
Cfr13I	GGNCC	1 cut(s)	134
CviJI	RGCY	3 cut(s)	99, 136, 165
CviKI_1	RGCY	3 cut(s)	99, 136, 165
DpnI	GATC	2 cut(s)	9, 48
DpnII	GATC	2 cut(s)	7, 46
EcoRII	CCWGG	1 cut(s)	136
Esp3I	CGTCTC	1 cut(s)	111
GsuI	CTGGAG	1 cut(s)	159
HaeIII	GGCC	1 cut(s)	136
Hpy166II	GTNNAC	1 cut(s)	93
Hpy8I	GTNNAC	1 cut(s)	93
HpyCH4V	TGCA	1 cut(s)	93
Kzo9I	GATC	2 cut(s)	7, 46
LpnPI	CCDG	2 cut(s)	123, 150
LweI	GCATC	1 cut(s)	141
MaeIII	GTNAC	1 cut(s)	115
MalI	GATC	2 cut(s)	9, 48
MboI	GATC	2 cut(s)	7, 46
MboII	GAAGA	3 cut(s)	56, 157, 160
MflI	RGATCY	1 cut(s)	46
MhlI	GDGCHC	1 cut(s)	95
MnlI	CCTC	1 cut(s)	58
MseI	TTAA	2 cut(s)	57, 172
MspR9I	CCNGG	1 cut(s)	138
MvaI	CCWGG	1 cut(s)	138
NdeII	GATC	2 cut(s)	7, 46
PshBI	ATTAAT	1 cut(s)	57
Psp6I	CCWGG	1 cut(s)	136
PspGI	CCWGG	1 cut(s)	136
PspPI	GGNCC	1 cut(s)	134
PsuI	RGATCY	1 cut(s)	46
SaqAI	TTAA	2 cut(s)	57, 172
Sau3AI	GATC	2 cut(s)	7, 46
Sau96I	GGNCC	1 cut(s)	134
ScrFI	CCNGG	1 cut(s)	138
SduI	GDGCHC	1 cut(s)	95
SetI	ASST	2 cut(s)	75, 167
SfaNI	GCATC	1 cut(s)	141
SgeI	CNNG	5 cut(s)	29, 108, 149, 150, 169
SmlI	CTYRAG	1 cut(s)	155
SmoI	CTYRAG	1 cut(s)	155
SspI	AATATT	1 cut(s)	61
StyD4I	CCNGG	1 cut(s)	136
TaqI	TCGA	1 cut(s)	16
Tru1I	TTAA	2 cut(s)	57, 172
Tru9I	TTAA	2 cut(s)	57, 172
TspDTI	ATGAA	1 cut(s)	101
VneI	GTGCAC	1 cut(s)	91
VspI	ATTAAT	1 cut(s)	57

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.