Rroxscaffold_2G00138210

ARID/BRIGHT DNA binding domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
76337007 .. 76340392
3386 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00138210.1

Sequence Viewer

Length: 174 bp
ATGATTGATCTCTGTCGAGTTGTTGGGTTGTGGGAGTTGTTTGAAGATCTCACTATTAATATTGAGGATAACCTACAAATGGAAATGAAGTGCACAAGCCATTCGTCTCAAATGGTAACAGATGTTGATGATGGGCCTGGAGAGAAGAAGATGCTCAAGGAGAGCTATTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.55

Weight (kDa)

4.27

Isoelectric Point (pI)

55.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 79
AgsI TTSAA 1 cut(s) 44
AjnI CCWGG 1 cut(s) 136
AluBI AGCT 1 cut(s) 165
AluI AGCT 1 cut(s) 165
Alw21I GWGCWC 1 cut(s) 95
Alw26I GTCTC 1 cut(s) 111
Alw44I GTGCAC 1 cut(s) 91
AoxI GGCC 1 cut(s) 134
ApaLI GTGCAC 1 cut(s) 91
AseI ATTAAT 1 cut(s) 57
AspS9I GGNCC 1 cut(s) 134
BaeGI GKGCMC 1 cut(s) 95
Bbv12I GWGCWC 1 cut(s) 95
BccI CCATC 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 138
BcoDI GTCTC 1 cut(s) 111
BglII AGATCT 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 138
BmgT120I GGNCC 1 cut(s) 134
BmrFI CCNGG 1 cut(s) 138
BmsI GCATC 1 cut(s) 141
BpmI CTGGAG 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 140
Bsc4I CCNNNNNNNGG 1 cut(s) 79
BseBI CCWGG 1 cut(s) 138
BseLI CCNNNNNNNGG 1 cut(s) 79
BseSI GKGCMC 1 cut(s) 95
BshFI GGCC 1 cut(s) 136
BsiHKAI GWGCWC 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 79
BsmAI GTCTC 1 cut(s) 111
BsmBI CGTCTC 1 cut(s) 111
BsnI GGCC 1 cut(s) 136
Bsp1286I GDGCHC 1 cut(s) 95
Bsp143I GATC 2 cut(s) 7, 46
BspANI GGCC 1 cut(s) 136
BssMI GATC 2 cut(s) 7, 46
Bst2UI CCWGG 1 cut(s) 138
BstKTI GATC 2 cut(s) 10, 49
BstMAI GTCTC 1 cut(s) 111
BstMBI GATC 2 cut(s) 7, 46
BstNI CCWGG 1 cut(s) 138
BstSCI CCNGG 1 cut(s) 136
BstSLI GKGCMC 1 cut(s) 95
BstX2I RGATCY 1 cut(s) 46
BstYI RGATCY 1 cut(s) 46
BsuRI GGCC 1 cut(s) 136
Cfr13I GGNCC 1 cut(s) 134
CviJI RGCY 3 cut(s) 99, 136, 165
CviKI_1 RGCY 3 cut(s) 99, 136, 165
DpnI GATC 2 cut(s) 9, 48
DpnII GATC 2 cut(s) 7, 46
EcoRII CCWGG 1 cut(s) 136
Esp3I CGTCTC 1 cut(s) 111
GsuI CTGGAG 1 cut(s) 159
HaeIII GGCC 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 93
Hpy8I GTNNAC 1 cut(s) 93
HpyCH4V TGCA 1 cut(s) 93
Kzo9I GATC 2 cut(s) 7, 46
LpnPI CCDG 2 cut(s) 123, 150
LweI GCATC 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 115
MalI GATC 2 cut(s) 9, 48
MboI GATC 2 cut(s) 7, 46
MboII GAAGA 3 cut(s) 56, 157, 160
MflI RGATCY 1 cut(s) 46
MhlI GDGCHC 1 cut(s) 95
MnlI CCTC 1 cut(s) 58
MseI TTAA 2 cut(s) 57, 172
MspR9I CCNGG 1 cut(s) 138
MvaI CCWGG 1 cut(s) 138
NdeII GATC 2 cut(s) 7, 46
PshBI ATTAAT 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 136
PspGI CCWGG 1 cut(s) 136
PspPI GGNCC 1 cut(s) 134
PsuI RGATCY 1 cut(s) 46
SaqAI TTAA 2 cut(s) 57, 172
Sau3AI GATC 2 cut(s) 7, 46
Sau96I GGNCC 1 cut(s) 134
ScrFI CCNGG 1 cut(s) 138
SduI GDGCHC 1 cut(s) 95
SetI ASST 2 cut(s) 75, 167
SfaNI GCATC 1 cut(s) 141
SgeI CNNG 5 cut(s) 29, 108, 149, 150, 169
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
SspI AATATT 1 cut(s) 61
StyD4I CCNGG 1 cut(s) 136
TaqI TCGA 1 cut(s) 16
Tru1I TTAA 2 cut(s) 57, 172
Tru9I TTAA 2 cut(s) 57, 172
TspDTI ATGAA 1 cut(s) 101
VneI GTGCAC 1 cut(s) 91
VspI ATTAAT 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.