Rroxscaffold_1G00021260

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
26091613 .. 26095378
3766 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00021260.1

Sequence Viewer

Length: 222 bp
ATGGAAATGAAGTGCACAAGCCATTCGTGTCAAATGGTAACAAATGTTGATGATGGGCCTGAGAGAAGAAGATGCTCAAGGAGAGCTATTCTTAATCAATGTCGACAGGTTAAATTACTGGAACTTCCTCAGATATTTCACCATATAAAGCTTTCTGTCGCATTTGAATGTGGTCGGACTCTATGTTACTCAAGATGGTCATGCCAAGACTCTGATCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.56

Weight (kDa)

8.57

Isoelectric Point (pI)

75.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 103
AgsI TTSAA 1 cut(s) 167
AluBI AGCT 2 cut(s) 86, 151
AluI AGCT 2 cut(s) 86, 151
Alw21I GWGCWC 1 cut(s) 17
Alw44I GTGCAC 1 cut(s) 13
AoxI GGCC 1 cut(s) 56
ApaLI GTGCAC 1 cut(s) 13
AspS9I GGNCC 1 cut(s) 56
AsuHPI GGTGA 1 cut(s) 131
BaeGI GKGCMC 1 cut(s) 17
Bbv12I GWGCWC 1 cut(s) 17
BccI CCATC 2 cut(s) 47, 189
BmgT120I GGNCC 1 cut(s) 56
BmsI GCATC 1 cut(s) 62
BpuEI CTTGAG 2 cut(s) 61, 175
Bse1I ACTGG 1 cut(s) 123
BseMII CTCAG 2 cut(s) 51, 143
BseNI ACTGG 1 cut(s) 123
BseSI GKGCMC 1 cut(s) 17
BshFI GGCC 1 cut(s) 58
BsiHKAI GWGCWC 1 cut(s) 17
BsnI GGCC 1 cut(s) 58
Bsp1286I GDGCHC 1 cut(s) 17
Bsp143I GATC 1 cut(s) 214
BspANI GGCC 1 cut(s) 58
BspCNI CTCAG 2 cut(s) 52, 142
BsrI ACTGG 1 cut(s) 123
BssMI GATC 1 cut(s) 214
BstDEI CTNAG 2 cut(s) 60, 129
BstKTI GATC 1 cut(s) 217
BstMBI GATC 1 cut(s) 214
BstSLI GKGCMC 1 cut(s) 17
BsuRI GGCC 1 cut(s) 58
Cfr13I GGNCC 1 cut(s) 56
CviAII CATG 1 cut(s) 201
CviJI RGCY 4 cut(s) 21, 58, 86, 151
CviKI_1 RGCY 4 cut(s) 21, 58, 86, 151
DdeI CTNAG 2 cut(s) 60, 129
DpnI GATC 1 cut(s) 216
DpnII GATC 1 cut(s) 214
FaeI CATG 1 cut(s) 204
FaiI YATR 4 cut(s) 144, 146, 184, 202
FatI CATG 1 cut(s) 200
FblI GTMKAC 1 cut(s) 103
HaeIII GGCC 1 cut(s) 58
Hin1II CATG 1 cut(s) 204
HincII GTYRAC 1 cut(s) 104
HindII GTYRAC 1 cut(s) 104
HindIII AAGCTT 1 cut(s) 149
HinfI GANTC 2 cut(s) 178, 209
HphI GGTGA 1 cut(s) 131
Hpy166II GTNNAC 2 cut(s) 15, 104
Hpy188I TCNGA 3 cut(s) 132, 177, 214
Hpy188III TCNNGA 1 cut(s) 192
Hpy8I GTNNAC 2 cut(s) 15, 104
HpyCH4V TGCA 1 cut(s) 15
HpyF3I CTNAG 2 cut(s) 60, 129
Hsp92II CATG 1 cut(s) 204
Kzo9I GATC 1 cut(s) 214
LpnPI CCDG 3 cut(s) 72, 92, 104
LweI GCATC 1 cut(s) 62
MaeIII GTNAC 2 cut(s) 37, 185
MalI GATC 1 cut(s) 216
MboI GATC 1 cut(s) 214
MboII GAAGA 2 cut(s) 78, 81
MhlI GDGCHC 1 cut(s) 17
MluCI AATT 1 cut(s) 113
MlyI GAGTC 2 cut(s) 172, 203
MmeI TCCRAC 1 cut(s) 155
MnlI CCTC 1 cut(s) 138
MseI TTAA 2 cut(s) 93, 111
MslI CAYNNNNRTG 1 cut(s) 166
NdeII GATC 1 cut(s) 214
NlaIII CATG 1 cut(s) 204
PleI GAGTC 2 cut(s) 172, 203
PpsI GAGTC 2 cut(s) 172, 203
PspPI GGNCC 1 cut(s) 56
RseI CAYNNNNRTG 1 cut(s) 166
SalI GTCGAC 1 cut(s) 102
SaqAI TTAA 2 cut(s) 93, 111
Sau3AI GATC 1 cut(s) 214
Sau96I GGNCC 1 cut(s) 56
SchI GAGTC 2 cut(s) 172, 203
SduI GDGCHC 1 cut(s) 17
SetI ASST 3 cut(s) 88, 111, 153
SfaNI GCATC 1 cut(s) 62
SgeI CNNG 9 cut(s) 30, 39, 71, 90, 119, 131, 204, 213, 218
SmiMI CAYNNNNRTG 1 cut(s) 166
SmlI CTYRAG 2 cut(s) 76, 190
SmoI CTYRAG 2 cut(s) 76, 190
Sse9I AATT 1 cut(s) 113
TaqI TCGA 1 cut(s) 103
TasI AATT 1 cut(s) 113
Tru1I TTAA 2 cut(s) 93, 111
Tru9I TTAA 2 cut(s) 93, 111
TspDTI ATGAA 1 cut(s) 23
VneI GTGCAC 1 cut(s) 13
XmiI GTMKAC 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.