Rroxscaffold_5G00371660

ARID/BRIGHT DNA binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0001197
Physical Location & Seq
Reverse (-)
53236760 .. 53238423
1664 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00371660.1

Sequence Viewer

Length: 177 bp
ATGATTGATCTCTGTCGAGTTGTTGTTGGGTTGTGCGAGTTGTTTGAAGATCTCACTATTAATATTGAGGATAACCTACAAATGGAAATGAAGGGCACAAGCCATTCGTCTCAAATGGTAACAAATGTTAATGATGGGCCTGGAGAGAAGAAGATGCTCAAGGAGAGCTATTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ARID

Protein Analysis

58

Amino Acids

6.52

Weight (kDa)

4.49

Isoelectric Point (pI)

41.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 82
AgsI TTSAA 1 cut(s) 47
AjnI CCWGG 1 cut(s) 139
AluBI AGCT 1 cut(s) 168
AluI AGCT 1 cut(s) 168
Alw26I GTCTC 1 cut(s) 114
AoxI GGCC 1 cut(s) 137
AseI ATTAAT 1 cut(s) 60
AspS9I GGNCC 1 cut(s) 137
BaeGI GKGCMC 1 cut(s) 98
BccI CCATC 1 cut(s) 128
BciT130I CCWGG 1 cut(s) 141
BcoDI GTCTC 1 cut(s) 114
BglII AGATCT 1 cut(s) 49
Bme1390I CCNGG 1 cut(s) 141
BmgT120I GGNCC 1 cut(s) 137
BmrFI CCNGG 1 cut(s) 141
BmsI GCATC 1 cut(s) 144
BpmI CTGGAG 1 cut(s) 162
BpuEI CTTGAG 1 cut(s) 143
Bsc4I CCNNNNNNNGG 1 cut(s) 82
BseBI CCWGG 1 cut(s) 141
BseLI CCNNNNNNNGG 1 cut(s) 82
BseSI GKGCMC 1 cut(s) 98
BshFI GGCC 1 cut(s) 139
BslI CCNNNNNNNGG 1 cut(s) 82
BsmAI GTCTC 1 cut(s) 114
BsmBI CGTCTC 1 cut(s) 114
BsnI GGCC 1 cut(s) 139
Bsp1286I GDGCHC 1 cut(s) 98
Bsp143I GATC 2 cut(s) 7, 49
BspANI GGCC 1 cut(s) 139
BssMI GATC 2 cut(s) 7, 49
Bst2UI CCWGG 1 cut(s) 141
BstKTI GATC 2 cut(s) 10, 52
BstMAI GTCTC 1 cut(s) 114
BstMBI GATC 2 cut(s) 7, 49
BstNI CCWGG 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 139
BstSLI GKGCMC 1 cut(s) 98
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BsuRI GGCC 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 137
CviJI RGCY 3 cut(s) 102, 139, 168
CviKI_1 RGCY 3 cut(s) 102, 139, 168
DpnI GATC 2 cut(s) 9, 51
DpnII GATC 2 cut(s) 7, 49
EcoRII CCWGG 1 cut(s) 139
Esp3I CGTCTC 1 cut(s) 114
GsuI CTGGAG 1 cut(s) 162
HaeIII GGCC 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 85
Kzo9I GATC 2 cut(s) 7, 49
LpnPI CCDG 2 cut(s) 126, 153
LweI GCATC 1 cut(s) 144
MaeIII GTNAC 1 cut(s) 118
MalI GATC 2 cut(s) 9, 51
MboI GATC 2 cut(s) 7, 49
MboII GAAGA 3 cut(s) 59, 160, 163
MflI RGATCY 1 cut(s) 49
MhlI GDGCHC 1 cut(s) 98
MnlI CCTC 1 cut(s) 61
MseI TTAA 3 cut(s) 60, 129, 175
MspR9I CCNGG 1 cut(s) 141
MvaI CCWGG 1 cut(s) 141
NdeII GATC 2 cut(s) 7, 49
PshBI ATTAAT 1 cut(s) 60
Psp6I CCWGG 1 cut(s) 139
PspGI CCWGG 1 cut(s) 139
PspPI GGNCC 1 cut(s) 137
PsuI RGATCY 1 cut(s) 49
SaqAI TTAA 3 cut(s) 60, 129, 175
Sau3AI GATC 2 cut(s) 7, 49
Sau96I GGNCC 1 cut(s) 137
ScrFI CCNGG 1 cut(s) 141
SduI GDGCHC 1 cut(s) 98
SetI ASST 2 cut(s) 78, 170
SfaNI GCATC 1 cut(s) 144
SgeI CNNG 6 cut(s) 29, 49, 111, 152, 153, 172
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
SspI AATATT 1 cut(s) 64
StyD4I CCNGG 1 cut(s) 139
TaqI TCGA 1 cut(s) 16
Tru1I TTAA 3 cut(s) 60, 129, 175
Tru9I TTAA 3 cut(s) 60, 129, 175
TspDTI ATGAA 1 cut(s) 104
VspI ATTAAT 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.