pycom111g03470
RLK Family

Cysteine-rich RLK (RECEPTOR-like protein kinase) 8

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_111
Physical Location & Seq
Reverse (-)
2136435 .. 2137354
920 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 747 bp
ATGGTGATAATGGTAATGGTCATACTGGTTCTTATCAAGCAAATGGTAGTTATCAAGGTGAAAGTTCAACCATGGGGGCAAATGGTTATCAAGGGGGTGAAAGCTCTAATGTGGGGGAAAATGGTTATCAAGGAGGATTTTGTTTTACTGGCAGTAATCAAAGGCATTTCAATACTCAAAATTGAAGGACATTCAATTCTAACAAGAATTCCTATGGACACAACGCTTCAAAACCTTACTTTGGCAACAAAAGTAGGGGATAAAATGGCAACTTTTCTGATCAAGGCAAGAGTTCACAGTCAAGTTTCAATGGTCAGTTCCATTACTCCTGAATGTCAAATATGCTCCAGAAAAGGTCACATTGCGCCTAATTGTCATTTTAAGAGTACAACTAATAGCAATCAATATCAACTCTTGGTATGTCAGATCTGTGGAAAGAAGGGCCACAATGCACTGGACTGTTTTCATAGGAACAATTATGCCTATCACGGGGCTCCACCACCTCCAACACTCACTGCCATGTCTGCACAAGGTTCACATAGTTACTCTCAAGTACCAAATAAGCCTCAACCACATGGGTTTTCTGCTGATGATACATGGGTCCTAGATATTGGTGCTACACATCATATGATAGCAAATGTCAACAATATGAATCAAGTCACTGCATACAATGGTGATGAGAAGATAATCATTGGAAATGGTCCAGGACAAGGCAACCAATGTGATACTCTATCAAGGAATGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

249

Amino Acids

27.26

Weight (kDa)

9.25

Isoelectric Point (pI)

23.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 207
AfaI GTAC 2 cut(s) 388, 555
AfiI CCNNNNNNNGG 3 cut(s) 241, 489, 710
AgsI TTSAA 6 cut(s) 68, 171, 185, 195, 230, 309
AjnI CCWGG 1 cut(s) 703
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AoxI GGCC 1 cut(s) 442
ApoI RAATTY 1 cut(s) 207
AspLEI GCGC 1 cut(s) 367
AspS9I GGNCC 3 cut(s) 442, 601, 701
AsuHPI GGTGA 4 cut(s) 16, 70, 109, 686
AvaII GGWCC 2 cut(s) 601, 701
BaeI ACNNNNGTAYC 2 cut(s) 585, 618
BanII GRGCYC 1 cut(s) 496
BciT130I CCWGG 1 cut(s) 705
BclI TGATCA 1 cut(s) 279
BfaI CTAG 1 cut(s) 605
BglII AGATCT 1 cut(s) 426
Bme1390I CCNGG 1 cut(s) 705
Bme18I GGWCC 2 cut(s) 601, 701
BmgT120I GGNCC 3 cut(s) 442, 601, 701
BmiI GGNNCC 2 cut(s) 495, 602
BmrFI CCNGG 1 cut(s) 705
BpmI CTGGAG 1 cut(s) 331
BpuEI CTTGAG 1 cut(s) 534
BsaJI CCNNGG 1 cut(s) 71
Bsc4I CCNNNNNNNGG 3 cut(s) 241, 489, 710
Bse1I ACTGG 3 cut(s) 30, 153, 459
Bse3DI GCAATG 1 cut(s) 360
BseBI CCWGG 1 cut(s) 705
BseDI CCNNGG 1 cut(s) 71
BseLI CCNNNNNNNGG 3 cut(s) 241, 489, 710
BseMI GCAATG 1 cut(s) 360
BseNI ACTGG 3 cut(s) 30, 153, 459
BsgI GTGCAG 1 cut(s) 510
BshFI GGCC 1 cut(s) 444
BslI CCNNNNNNNGG 3 cut(s) 241, 489, 710
BsnI GGCC 1 cut(s) 444
Bsp1286I GDGCHC 1 cut(s) 496
Bsp143I GATC 2 cut(s) 279, 426
Bsp19I CCATGG 1 cut(s) 71
BspANI GGCC 1 cut(s) 444
BspLI GGNNCC 2 cut(s) 495, 602
BsrDI GCAATG 1 cut(s) 360
BsrI ACTGG 3 cut(s) 30, 153, 459
BssECI CCNNGG 1 cut(s) 71
BssMI GATC 2 cut(s) 279, 426
BssT1I CCWWGG 1 cut(s) 71
Bst2UI CCWGG 1 cut(s) 705
Bst4CI ACNGT 2 cut(s) 299, 461
BstDSI CCRYGG 1 cut(s) 71
BstHHI GCGC 1 cut(s) 367
BstKTI GATC 2 cut(s) 282, 429
BstMBI GATC 2 cut(s) 279, 426
BstMWI GCNNNNNNNGC 1 cut(s) 524
BstNI CCWGG 1 cut(s) 705
BstSCI CCNGG 1 cut(s) 703
BstX2I RGATCY 1 cut(s) 426
BstYI RGATCY 1 cut(s) 426
BsuRI GGCC 1 cut(s) 444
BtgI CCRYGG 1 cut(s) 71
BtsI GCAGTG 2 cut(s) 513, 660
BtsIMutI CAGTG 3 cut(s) 452, 513, 660
CfoI GCGC 1 cut(s) 367
Cfr13I GGNCC 3 cut(s) 442, 601, 701
Csp6I GTAC 2 cut(s) 387, 554
CviAII CATG 4 cut(s) 72, 520, 575, 597
CviJI RGCY 4 cut(s) 104, 444, 494, 565
CviKI_1 RGCY 4 cut(s) 104, 444, 494, 565
CviQI GTAC 2 cut(s) 387, 554
DpnI GATC 2 cut(s) 281, 428
DpnII GATC 2 cut(s) 279, 426
Eco130I CCWWGG 1 cut(s) 71
Eco24I GRGCYC 1 cut(s) 496
Eco47I GGWCC 2 cut(s) 601, 701
EcoO109I RGGNCCY 1 cut(s) 601
EcoRI GAATTC 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 703
EcoT14I CCWWGG 1 cut(s) 71
EcoT38I GRGCYC 1 cut(s) 496
ErhI CCWWGG 1 cut(s) 71
FaeI CATG 4 cut(s) 75, 523, 578, 600
FatI CATG 4 cut(s) 71, 519, 574, 596
FauNDI CATATG 1 cut(s) 627
FbaI TGATCA 1 cut(s) 279
FriOI GRGCYC 1 cut(s) 496
FspBI CTAG 1 cut(s) 605
GlaI GCGC 1 cut(s) 366
GsuI CTGGAG 1 cut(s) 331
HaeIII GGCC 1 cut(s) 444
HhaI GCGC 1 cut(s) 367
Hin1II CATG 4 cut(s) 75, 523, 578, 600
Hin6I GCGC 1 cut(s) 365
HinP1I GCGC 1 cut(s) 365
HincII GTYRAC 1 cut(s) 643
HindII GTYRAC 1 cut(s) 643
HinfI GANTC 1 cut(s) 652
HphI GGTGA 4 cut(s) 16, 70, 109, 686
Hpy166II GTNNAC 3 cut(s) 295, 536, 643
Hpy188I TCNGA 2 cut(s) 279, 426
Hpy188III TCNNGA 2 cut(s) 329, 348
Hpy8I GTNNAC 3 cut(s) 295, 536, 643
HpyAV CCTTC 2 cut(s) 179, 433
HpyCH4III ACNGT 2 cut(s) 299, 461
HpyCH4V TGCA 3 cut(s) 452, 527, 665
HpyF10VI GCNNNNNNNGC 1 cut(s) 524
Hsp92II CATG 4 cut(s) 75, 523, 578, 600
HspAI GCGC 1 cut(s) 365
Ksp22I TGATCA 1 cut(s) 279
Kzo9I GATC 2 cut(s) 279, 426
LmnI GCTCC 2 cut(s) 350, 499
LpnPI CCDG 7 cut(s) 11, 134, 342, 361, 440, 690, 717
MaeI CTAG 1 cut(s) 605
MaeIII GTNAC 3 cut(s) 356, 542, 658
MalI GATC 2 cut(s) 281, 428
MboI GATC 2 cut(s) 279, 426
MboII GAAGA 1 cut(s) 694
MflI RGATCY 1 cut(s) 426
MhlI GDGCHC 1 cut(s) 496
MluCI AATT 5 cut(s) 180, 195, 207, 370, 475
MmeI TCCRAC 1 cut(s) 530
MnlI CCTC 3 cut(s) 127, 513, 576
MseI TTAA 1 cut(s) 381
MslI CAYNNNNRTG 1 cut(s) 518
MspR9I CCNGG 1 cut(s) 705
MvaI CCWGG 1 cut(s) 705
MwoI GCNNNNNNNGC 1 cut(s) 524
NcoI CCATGG 1 cut(s) 71
NdeI CATATG 1 cut(s) 627
NdeII GATC 2 cut(s) 279, 426
NlaIII CATG 4 cut(s) 75, 523, 578, 600
NlaIV GGNNCC 2 cut(s) 495, 602
NmuCI GTSAC 2 cut(s) 356, 658
PfeI GAWTC 1 cut(s) 652
PfoI TCCNGGA 1 cut(s) 703
PpuMI RGGWCCY 1 cut(s) 601
Psp5II RGGWCCY 1 cut(s) 601
Psp6I CCWGG 1 cut(s) 703
PspGI CCWGG 1 cut(s) 703
PspN4I GGNNCC 2 cut(s) 495, 602
PspPI GGNCC 3 cut(s) 442, 601, 701
PspPPI RGGWCCY 1 cut(s) 601
PsuI RGATCY 1 cut(s) 426
RsaI GTAC 2 cut(s) 388, 555
RsaNI GTAC 2 cut(s) 387, 554
RseI CAYNNNNRTG 1 cut(s) 518
SaqAI TTAA 1 cut(s) 381
Sau3AI GATC 2 cut(s) 279, 426
Sau96I GGNCC 3 cut(s) 442, 601, 701
ScrFI CCNGG 1 cut(s) 705
SduI GDGCHC 1 cut(s) 496
SetI ASST 6 cut(s) 60, 106, 237, 358, 505, 535
SinI GGWCC 2 cut(s) 601, 701
SmiMI CAYNNNNRTG 1 cut(s) 518
SmlI CTYRAG 1 cut(s) 549
SmoI CTYRAG 1 cut(s) 549
Sse9I AATT 5 cut(s) 180, 195, 207, 370, 475
SspMI CTAG 1 cut(s) 605
StyD4I CCNGG 1 cut(s) 703
StyI CCWWGG 1 cut(s) 71
TaaI ACNGT 2 cut(s) 299, 461
TasI AATT 5 cut(s) 180, 195, 207, 370, 475
TatI WGTACW 1 cut(s) 386
TfiI GAWTC 1 cut(s) 652
Tru1I TTAA 1 cut(s) 381
Tru9I TTAA 1 cut(s) 381
TscAI CASTG 3 cut(s) 459, 520, 667
TseFI GTSAC 2 cut(s) 356, 658
Tsp45I GTSAC 2 cut(s) 356, 658
TspDTI ATGAA 2 cut(s) 455, 665
TspRI CASTG 3 cut(s) 459, 520, 667
VpaK11BI GGWCC 2 cut(s) 601, 701
XapI RAATTY 1 cut(s) 207
XspI CTAG 1 cut(s) 605
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.