pycom14g19720
RLK Family

Cysteine-rich RLK (RECEPTOR-like protein kinase) 8

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Reverse (-)
20952776 .. 20953267
492 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 492 bp
ATGGACGAAAGAATTTTCATTCACAGCAAAAGAATACTTTCAACAGTAATAACAACAGGTTTTATGGCAATAACAATAATTCCAGGTCTTTTTCAAACTTTGGAAATAGATAACTCCAATGGATACACAAATAATGGGAAAAGTCCACAGCATGGCACAAATGGAGCAAATGGTTCATTTCCTGGTAATAATTCAGATTTTGGAAACAATTTCTCTGGAAGCAGTTTTAAGCAAGGAAGCAACTGGAATGGAAACACCAATTATAAGTCTACAGTGTCACTTGAATGTCAGATCTATTTAAGAAGTGGTCATACAACTCCAAATTGTTATCAAAGACATACTTTCAATGCTCTTTCATCAAATGGATTTCTGGTATGTCAAATATGTGGAAAGAAAGGACACACAGCTCTGGAGTGCTATCACAGGAACAACTATGCTTATCAAGGTGGAACTCCACCTCAATCTCTTGTAGGAATGACTGCACAAGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

164

Amino Acids

17.74

Weight (kDa)

8.87

Isoelectric Point (pI)

23.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 264
AccB7I CCANNNNNTGG 1 cut(s) 152
AccI GTMKAC 1 cut(s) 269
AcsI RAATTY 1 cut(s) 12
AfiI CCNNNNNNNGG 1 cut(s) 152
AgsI TTSAA 4 cut(s) 42, 95, 284, 346
AjnI CCWGG 2 cut(s) 82, 181
AluBI AGCT 1 cut(s) 407
AluI AGCT 1 cut(s) 407
ApoI RAATTY 1 cut(s) 12
Asp700I GAANNNNTTC 1 cut(s) 37
BarI GAAGNNNNNNTAC 2 cut(s) 295, 327
BciT130I CCWGG 2 cut(s) 84, 183
BciVI GTATCC 1 cut(s) 116
BfmI CTRYAG 1 cut(s) 270
BfuI GTATCC 1 cut(s) 116
BglII AGATCT 1 cut(s) 291
Bme1390I CCNGG 2 cut(s) 84, 183
BmrFI CCNGG 2 cut(s) 84, 183
BpmI CTGGAG 1 cut(s) 431
Bsc4I CCNNNNNNNGG 1 cut(s) 152
Bse1I ACTGG 1 cut(s) 248
BseBI CCWGG 2 cut(s) 84, 183
BseLI CCNNNNNNNGG 1 cut(s) 152
BseNI ACTGG 1 cut(s) 248
BsgI GTGCAG 1 cut(s) 465
BslI CCNNNNNNNGG 1 cut(s) 152
Bsp143I GATC 1 cut(s) 291
BsrI ACTGG 1 cut(s) 248
BssMI GATC 1 cut(s) 291
Bst2UI CCWGG 2 cut(s) 84, 183
Bst4CI ACNGT 2 cut(s) 46, 274
BstKTI GATC 1 cut(s) 294
BstMBI GATC 1 cut(s) 291
BstNI CCWGG 2 cut(s) 84, 183
BstSCI CCNGG 2 cut(s) 82, 181
BstSFI CTRYAG 1 cut(s) 270
BstX2I RGATCY 1 cut(s) 291
BstYI RGATCY 1 cut(s) 291
BsuI GTATCC 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 279
CviAII CATG 1 cut(s) 152
CviJI RGCY 1 cut(s) 407
CviKI_1 RGCY 1 cut(s) 407
DpnI GATC 1 cut(s) 293
DpnII GATC 1 cut(s) 291
EcoRII CCWGG 2 cut(s) 82, 181
FaeI CATG 1 cut(s) 155
FaiI YATR 8 cut(s) 65, 153, 264, 312, 339, 376, 385, 435
FalI AAGNNNNNCTT 2 cut(s) 325, 357
FatI CATG 1 cut(s) 151
FblI GTMKAC 1 cut(s) 269
GsuI CTGGAG 1 cut(s) 431
Hin1II CATG 1 cut(s) 155
Hpy166II GTNNAC 2 cut(s) 146, 270
Hpy188I TCNGA 2 cut(s) 196, 291
Hpy188III TCNNGA 2 cut(s) 216, 410
Hpy8I GTNNAC 2 cut(s) 146, 270
HpyCH4III ACNGT 2 cut(s) 46, 274
HpyCH4V TGCA 1 cut(s) 482
Hsp92II CATG 1 cut(s) 155
Kzo9I GATC 1 cut(s) 291
LmnI GCTCC 1 cut(s) 164
MaeIII GTNAC 1 cut(s) 276
MalI GATC 1 cut(s) 293
MboI GATC 1 cut(s) 291
MflI RGATCY 1 cut(s) 291
MluCI AATT 6 cut(s) 12, 78, 190, 208, 259, 322
MnlI CCTC 1 cut(s) 468
MroXI GAANNNNTTC 1 cut(s) 37
MseI TTAA 2 cut(s) 228, 299
MslI CAYNNNNRTG 1 cut(s) 283
MspR9I CCNGG 2 cut(s) 84, 183
MvaI CCWGG 2 cut(s) 84, 183
NdeII GATC 1 cut(s) 291
NlaIII CATG 1 cut(s) 155
NmuCI GTSAC 1 cut(s) 276
PdmI GAANNNNTTC 1 cut(s) 37
PflMI CCANNNNNTGG 1 cut(s) 152
PsiI TTATAA 1 cut(s) 264
Psp6I CCWGG 2 cut(s) 82, 181
PspGI CCWGG 2 cut(s) 82, 181
PsuI RGATCY 1 cut(s) 291
RseI CAYNNNNRTG 1 cut(s) 283
SaqAI TTAA 2 cut(s) 228, 299
Sau3AI GATC 1 cut(s) 291
ScrFI CCNGG 2 cut(s) 84, 183
SetI ASST 6 cut(s) 61, 88, 409, 448, 460, 490
SfcI CTRYAG 1 cut(s) 270
SmiMI CAYNNNNRTG 1 cut(s) 283
Sse9I AATT 6 cut(s) 12, 78, 190, 208, 259, 322
StyD4I CCNGG 2 cut(s) 82, 181
TaaI ACNGT 2 cut(s) 46, 274
TasI AATT 6 cut(s) 12, 78, 190, 208, 259, 322
Tru1I TTAA 2 cut(s) 228, 299
Tru9I TTAA 2 cut(s) 228, 299
TscAI CASTG 1 cut(s) 279
TseFI GTSAC 1 cut(s) 276
Tsp45I GTSAC 1 cut(s) 276
TspDTI ATGAA 3 cut(s) 7, 165, 345
TspRI CASTG 1 cut(s) 279
Van91I CCANNNNNTGG 1 cut(s) 152
XapI RAATTY 1 cut(s) 12
XmiI GTMKAC 1 cut(s) 269
XmnI GAANNNNTTC 1 cut(s) 37
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.