RchiOBHm_Chr5g0078201

lysine-specific demethylase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
84115395 .. 84117073
1679 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGCTTTGCAACTCAAGTCAGGTTGATCTAGACAACATAGATGAGAAAGAATTCCTGGAGTTGCAGGACTTAGAATTTCTTGACTGCATTTTAGAGGAAGGTGACATGCTTTATATCCCACCAAAGTGGTGGCACTATGTGCGGTCTCTGACAACAAGTATGTCGGTTAGCTTTTGGTGCAGTGATTATGACAGTTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.75

Weight (kDa)

4.05

Isoelectric Point (pI)

68.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cupin_8 PF13621 4 - 59 3.3e-15 Cupin-like domain
JmjC_2 PF08007 12 - 58 3.9e-10 JmjC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 142
AcsI RAATTY 2 cut(s) 50, 74
AdeI CACNNNGTG 1 cut(s) 139
AjnI CCWGG 1 cut(s) 54
AleI CACNNNNGTG 1 cut(s) 124
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
Alw26I GTCTC 1 cut(s) 150
ApoI RAATTY 2 cut(s) 50, 74
Asp700I GAANNNNTTC 1 cut(s) 50
AsuHPI GGTGA 1 cut(s) 113
BciT130I CCWGG 1 cut(s) 56
BcoDI GTCTC 1 cut(s) 150
BfaI CTAG 1 cut(s) 29
Bme1390I CCNGG 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 56
BpmI CTGGAG 1 cut(s) 77
BsaI GGTCTC 1 cut(s) 150
BseBI CCWGG 1 cut(s) 56
BsmAI GTCTC 1 cut(s) 150
Bso31I GGTCTC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 25
BspACI CCGC 1 cut(s) 142
BspTNI GGTCTC 1 cut(s) 150
BssMI GATC 1 cut(s) 25
Bst2UI CCWGG 1 cut(s) 56
Bst4CI ACNGT 1 cut(s) 194
BstAPI GCANNNNNTGC 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 70
BstKTI GATC 1 cut(s) 28
BstMAI GTCTC 1 cut(s) 150
BstMBI GATC 1 cut(s) 25
BstMWI GCNNNNNNNGC 2 cut(s) 139, 177
BstNI CCWGG 1 cut(s) 56
BstNSI RCATGY 1 cut(s) 109
BstSCI CCNGG 1 cut(s) 54
BstXI CCANNNNNNTGG 2 cut(s) 126, 129
BtsI GCAGTG 1 cut(s) 187
BtsIMutI CAGTG 1 cut(s) 187
CviAII CATG 1 cut(s) 106
CviJI RGCY 1 cut(s) 171
CviKI_1 RGCY 1 cut(s) 171
DdeI CTNAG 1 cut(s) 70
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
DraIII CACNNNGTG 1 cut(s) 139
Eco31I GGTCTC 1 cut(s) 150
EcoRI GAATTC 1 cut(s) 50
EcoRII CCWGG 1 cut(s) 54
FaeI CATG 1 cut(s) 109
FaiI YATR 6 cut(s) 38, 107, 114, 138, 161, 189
FatI CATG 1 cut(s) 105
FspBI CTAG 1 cut(s) 29
GsuI CTGGAG 1 cut(s) 77
Hin1II CATG 1 cut(s) 109
HphI GGTGA 1 cut(s) 113
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 2 cut(s) 29, 80
HpyAV CCTTC 1 cut(s) 92
HpyCH4III ACNGT 1 cut(s) 194
HpyCH4V TGCA 4 cut(s) 9, 64, 87, 180
HpyF10VI GCNNNNNNNGC 2 cut(s) 139, 177
HpyF3I CTNAG 1 cut(s) 70
Hsp92II CATG 1 cut(s) 109
Kzo9I GATC 1 cut(s) 25
LpnPI CCDG 4 cut(s) 5, 41, 50, 68
MaeI CTAG 1 cut(s) 29
MaeIII GTNAC 1 cut(s) 101
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MluCI AATT 2 cut(s) 50, 74
MnlI CCTC 1 cut(s) 88
MroXI GAANNNNTTC 1 cut(s) 50
MseI TTAA 1 cut(s) 196
MslI CAYNNNNRTG 1 cut(s) 124
MspR9I CCNGG 1 cut(s) 56
MvaI CCWGG 1 cut(s) 56
MwoI GCNNNNNNNGC 2 cut(s) 139, 177
NdeII GATC 1 cut(s) 25
NlaIII CATG 1 cut(s) 109
NmuCI GTSAC 1 cut(s) 101
NspI RCATGY 1 cut(s) 109
OliI CACNNNNGTG 1 cut(s) 124
PdmI GAANNNNTTC 1 cut(s) 50
PfoI TCCNGGA 1 cut(s) 54
Psp6I CCWGG 1 cut(s) 54
PspGI CCWGG 1 cut(s) 54
RseI CAYNNNNRTG 1 cut(s) 124
SaqAI TTAA 1 cut(s) 196
Sau3AI GATC 1 cut(s) 25
ScrFI CCNGG 1 cut(s) 56
SetI ASST 3 cut(s) 24, 103, 173
SgeI CNNG 9 cut(s) 27, 32, 41, 67, 68, 77, 92, 118, 168
SmiMI CAYNNNNRTG 1 cut(s) 124
SmlI CTYRAG 1 cut(s) 13
SmoI CTYRAG 1 cut(s) 13
Sse9I AATT 2 cut(s) 50, 74
SsiI CCGC 1 cut(s) 142
SspMI CTAG 1 cut(s) 29
StyD4I CCNGG 1 cut(s) 54
TaaI ACNGT 1 cut(s) 194
TasI AATT 2 cut(s) 50, 74
Tru1I TTAA 1 cut(s) 196
Tru9I TTAA 1 cut(s) 196
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 1 cut(s) 101
Tsp45I GTSAC 1 cut(s) 101
TspRI CASTG 1 cut(s) 187
XapI RAATTY 2 cut(s) 50, 74
XbaI TCTAGA 1 cut(s) 28
XceI RCATGY 1 cut(s) 109
XcmI CCANNNNNNNNNTGG 1 cut(s) 126
XmnI GAANNNNTTC 1 cut(s) 50
XspI CTAG 1 cut(s) 29
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.