Rh5CG321900

Protein SAWADEE HOMEODOMAIN HOMOLOG

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0000905
Physical Location & Seq
Reverse (-)
35595592 .. 35596423
832 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG321900.1

Sequence Viewer

Length: 276 bp
ATGGACCATGGCCTTTGTCCCAGACAGAGGGAGTTCTTCATTGGCTTCACAAAGGGCCAGATGGAGAGTGGACAAATTGGTGAGGGAGTCCAGAGAAGCAGTACTTGCCAAGAATTTTGTCAAAATTTGGCAAAAAGTTTTAATCACTCAGCTAGTCGTGCTGGAAAACCAATTGTGAAATGGATTCAGGTGCAAAATTGGTTCCAGGAAAGGATGCAAGAGTTACCAAACATATTAAAAGATCTCCAGGGATTTCCCCTTCCACTAAGCACCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SAWADEE

Protein Analysis

91

Amino Acids

10.41

Weight (kDa)

8.59

Isoelectric Point (pI)

36.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 113, 124
AfaI GTAC 1 cut(s) 103
AfiI CCNNNNNNNGG 1 cut(s) 27
AjnI CCWGG 2 cut(s) 204, 246
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
AoxI GGCC 2 cut(s) 10, 55
ApoI RAATTY 2 cut(s) 113, 124
AspS9I GGNCC 2 cut(s) 4, 55
AsuHPI GGTGA 1 cut(s) 92
AvaII GGWCC 1 cut(s) 4
BccI CCATC 1 cut(s) 55
BciT130I CCWGG 2 cut(s) 206, 248
BfaI CTAG 1 cut(s) 153
BglII AGATCT 1 cut(s) 241
BmcAI AGTACT 1 cut(s) 103
Bme1390I CCNGG 2 cut(s) 206, 248
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 2 cut(s) 4, 55
BmiI GGNNCC 1 cut(s) 203
BmrFI CCNGG 2 cut(s) 206, 248
BmsI GCATC 1 cut(s) 204
BpmI CTGGAG 1 cut(s) 230
BsaJI CCNNGG 2 cut(s) 7, 247
Bsc4I CCNNNNNNNGG 1 cut(s) 27
BseBI CCWGG 2 cut(s) 206, 248
BseDI CCNNGG 2 cut(s) 7, 247
BseGI GGATG 1 cut(s) 219
BseLI CCNNNNNNNGG 1 cut(s) 27
BseMII CTCAG 1 cut(s) 162
BshFI GGCC 2 cut(s) 12, 57
BslFI GGGAC 1 cut(s) 3
BslI CCNNNNNNNGG 1 cut(s) 27
BsmFI GGGAC 1 cut(s) 3
BsnI GGCC 2 cut(s) 12, 57
Bsp143I GATC 1 cut(s) 241
Bsp19I CCATGG 1 cut(s) 7
BspANI GGCC 2 cut(s) 12, 57
BspCNI CTCAG 1 cut(s) 161
BspLI GGNNCC 1 cut(s) 203
BssECI CCNNGG 2 cut(s) 7, 247
BssMI GATC 1 cut(s) 241
BssT1I CCWWGG 1 cut(s) 7
Bst2UI CCWGG 2 cut(s) 206, 248
BstAPI GCANNNNNTGC 1 cut(s) 105
BstDEI CTNAG 2 cut(s) 148, 266
BstDSI CCRYGG 1 cut(s) 7
BstF5I GGATG 1 cut(s) 219
BstKTI GATC 1 cut(s) 244
BstMBI GATC 1 cut(s) 241
BstMWI GCNNNNNNNGC 2 cut(s) 105, 158
BstNI CCWGG 2 cut(s) 206, 248
BstSCI CCNGG 2 cut(s) 204, 246
BstX2I RGATCY 1 cut(s) 241
BstYI RGATCY 1 cut(s) 241
BsuRI GGCC 2 cut(s) 12, 57
BtgI CCRYGG 1 cut(s) 7
BtsCI GGATG 1 cut(s) 219
Cfr13I GGNCC 2 cut(s) 4, 55
Csp6I GTAC 1 cut(s) 102
CviAII CATG 1 cut(s) 8
CviJI RGCY 4 cut(s) 12, 45, 57, 152
CviKI_1 RGCY 4 cut(s) 12, 45, 57, 152
CviQI GTAC 1 cut(s) 102
DdeI CTNAG 2 cut(s) 148, 266
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
Eco130I CCWWGG 1 cut(s) 7
Eco47I GGWCC 1 cut(s) 4
EcoRII CCWGG 2 cut(s) 204, 246
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaeI CATG 1 cut(s) 11
FaiI YATR 2 cut(s) 9, 233
FalI AAGNNNNNCTT 2 cut(s) 88, 120
FaqI GGGAC 1 cut(s) 3
FatI CATG 1 cut(s) 7
FokI GGATG 1 cut(s) 226
FspBI CTAG 1 cut(s) 153
GsuI CTGGAG 1 cut(s) 230
HaeIII GGCC 2 cut(s) 12, 57
Hin1II CATG 1 cut(s) 11
HinfI GANTC 2 cut(s) 87, 184
HphI GGTGA 1 cut(s) 92
Hpy166II GTNNAC 1 cut(s) 71
Hpy188III TCNNGA 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 269
HpyCH4V TGCA 2 cut(s) 193, 217
HpyF10VI GCNNNNNNNGC 2 cut(s) 105, 158
HpyF3I CTNAG 2 cut(s) 148, 266
Hsp92II CATG 1 cut(s) 11
Kzo9I GATC 1 cut(s) 241
LpnPI CCDG 9 cut(s) 34, 71, 104, 147, 173, 191, 218, 233, 260
LweI GCATC 1 cut(s) 204
MaeI CTAG 1 cut(s) 153
MaeIII GTNAC 1 cut(s) 222
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MboII GAAGA 1 cut(s) 28
MfeI CAATTG 1 cut(s) 171
MflI RGATCY 1 cut(s) 241
MluCI AATT 5 cut(s) 75, 113, 124, 171, 196
MlyI GAGTC 1 cut(s) 96
MnlI CCTC 2 cut(s) 21, 76
MseI TTAA 2 cut(s) 141, 236
MspR9I CCNGG 2 cut(s) 206, 248
MunI CAATTG 1 cut(s) 171
MvaI CCWGG 2 cut(s) 206, 248
MwoI GCNNNNNNNGC 2 cut(s) 105, 158
NcoI CCATGG 1 cut(s) 7
NdeII GATC 1 cut(s) 241
NlaIII CATG 1 cut(s) 11
NlaIV GGNNCC 1 cut(s) 203
PfeI GAWTC 1 cut(s) 184
PfoI TCCNGGA 1 cut(s) 204
PleI GAGTC 1 cut(s) 95
PpsI GAGTC 1 cut(s) 95
Psp6I CCWGG 2 cut(s) 204, 246
PspGI CCWGG 2 cut(s) 204, 246
PspN4I GGNNCC 1 cut(s) 203
PspPI GGNCC 2 cut(s) 4, 55
PsuI RGATCY 1 cut(s) 241
RsaI GTAC 1 cut(s) 103
RsaNI GTAC 1 cut(s) 102
SaqAI TTAA 2 cut(s) 141, 236
Sau3AI GATC 1 cut(s) 241
Sau96I GGNCC 2 cut(s) 4, 55
ScaI AGTACT 1 cut(s) 103
SchI GAGTC 1 cut(s) 96
ScrFI CCNGG 2 cut(s) 206, 248
SetI ASST 3 cut(s) 154, 192, 275
SfaNI GCATC 1 cut(s) 204
SinI GGWCC 1 cut(s) 4
Sse9I AATT 5 cut(s) 75, 113, 124, 171, 196
SspMI CTAG 1 cut(s) 153
StyD4I CCNGG 2 cut(s) 204, 246
StyI CCWWGG 1 cut(s) 7
TasI AATT 5 cut(s) 75, 113, 124, 171, 196
TatI WGTACW 1 cut(s) 101
TfiI GAWTC 1 cut(s) 184
Tru1I TTAA 2 cut(s) 141, 236
Tru9I TTAA 2 cut(s) 141, 236
TspDTI ATGAA 1 cut(s) 28
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 2 cut(s) 113, 124
XcmI CCANNNNNNNNNTGG 2 cut(s) 65, 177
XspI CTAG 1 cut(s) 153
ZrmI AGTACT 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.