Rw5G047830

lysine-specific demethylase

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
82889657 .. 82893965
4309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G047830.1

Sequence Viewer

Length: 282 bp
ATGGACAAATTGGTGAGGGAGTCAGGAGAAGTCGTGCTTGCCAAAGAATGTTGTCAAAATCTGGCAAAAAGTTTTAATCACTCCGGTGGTCGTGCTGGAAAACCAATTGTGAAATGGATTCAGGTTGATCTAGACAACATAGAGGAGGAAGAATTCCCAGGGGTGCAGGACTTAGAATTTCTTGACTGCATTTTAGAGGAAGGTGACATGCTTTATATCCCACCAAAGTGGTGGCACAATGTGCGGTCTTTGACAATGAGTATGTCGGTTACGGTGGAGTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.62

Weight (kDa)

4.64

Isoelectric Point (pI)

58.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cupin_8 PF13621 38 - 91 2.4e-13 Cupin-like domain
JmjC_2 PF08007 39 - 92 1.7e-09 JmjC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 244
AcsI RAATTY 2 cut(s) 152, 176
AdeI CACNNNGTG 1 cut(s) 241
AjnI CCWGG 1 cut(s) 157
AleI CACNNNNGTG 2 cut(s) 84, 226
ApoI RAATTY 2 cut(s) 152, 176
AsuHPI GGTGA 2 cut(s) 25, 215
BciT130I CCWGG 1 cut(s) 159
BfaI CTAG 1 cut(s) 131
Bme1390I CCNGG 1 cut(s) 159
BmrFI CCNGG 1 cut(s) 159
BsaJI CCNNGG 2 cut(s) 157, 158
BsaWI WCCGGW 1 cut(s) 83
BsaXI ACNNNNNCTCC 2 cut(s) 18, 48
BseBI CCWGG 1 cut(s) 159
BseDI CCNNGG 2 cut(s) 157, 158
BseRI GAGGAG 1 cut(s) 158
BsgI GTGCAG 1 cut(s) 185
BsiSI CCGG 1 cut(s) 84
Bsp143I GATC 1 cut(s) 127
BspACI CCGC 1 cut(s) 244
BssECI CCNNGG 2 cut(s) 157, 158
BssMI GATC 1 cut(s) 127
Bst2UI CCWGG 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 274
BstAPI GCANNNNNTGC 1 cut(s) 241
BstC8I GCNNGC 1 cut(s) 39
BstDEI CTNAG 1 cut(s) 172
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstMWI GCNNNNNNNGC 1 cut(s) 241
BstNI CCWGG 1 cut(s) 159
BstNSI RCATGY 1 cut(s) 211
BstSCI CCNGG 1 cut(s) 157
BstXI CCANNNNNNTGG 2 cut(s) 228, 231
Cac8I GCNNGC 1 cut(s) 39
CviAII CATG 1 cut(s) 208
DdeI CTNAG 1 cut(s) 172
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
DraIII CACNNNGTG 1 cut(s) 241
EcoRI GAATTC 1 cut(s) 152
EcoRII CCWGG 1 cut(s) 157
FaeI CATG 1 cut(s) 211
FaiI YATR 4 cut(s) 140, 209, 216, 263
FalI AAGNNNNNCTT 2 cut(s) 21, 53
FatI CATG 1 cut(s) 207
FspBI CTAG 1 cut(s) 131
HapII CCGG 1 cut(s) 84
Hin1II CATG 1 cut(s) 211
HinfI GANTC 2 cut(s) 20, 118
HpaII CCGG 1 cut(s) 84
HphI GGTGA 2 cut(s) 25, 215
Hpy188III TCNNGA 3 cut(s) 24, 131, 182
HpyAV CCTTC 1 cut(s) 194
HpyCH4III ACNGT 1 cut(s) 274
HpyCH4V TGCA 2 cut(s) 166, 189
HpyF10VI GCNNNNNNNGC 1 cut(s) 241
HpyF3I CTNAG 1 cut(s) 172
Hsp92II CATG 1 cut(s) 211
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 8 cut(s) 9, 47, 81, 97, 107, 144, 152, 171
MaeI CTAG 1 cut(s) 131
MaeIII GTNAC 2 cut(s) 203, 268
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 1 cut(s) 161
MfeI CAATTG 1 cut(s) 105
MluCI AATT 4 cut(s) 8, 105, 152, 176
MlyI GAGTC 1 cut(s) 29
MnlI CCTC 4 cut(s) 9, 136, 139, 190
MseI TTAA 1 cut(s) 75
MslI CAYNNNNRTG 2 cut(s) 84, 226
MspI CCGG 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 159
MunI CAATTG 1 cut(s) 105
MvaI CCWGG 1 cut(s) 159
MwoI GCNNNNNNNGC 1 cut(s) 241
NdeII GATC 1 cut(s) 127
NlaIII CATG 1 cut(s) 211
NmuCI GTSAC 1 cut(s) 203
NspI RCATGY 1 cut(s) 211
OliI CACNNNNGTG 2 cut(s) 84, 226
PasI CCCWGGG 1 cut(s) 158
PfeI GAWTC 1 cut(s) 118
PleI GAGTC 1 cut(s) 28
PpsI GAGTC 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
RseI CAYNNNNRTG 2 cut(s) 84, 226
SaqAI TTAA 1 cut(s) 75
Sau3AI GATC 1 cut(s) 127
SchI GAGTC 1 cut(s) 29
ScrFI CCNGG 1 cut(s) 159
SetI ASST 2 cut(s) 126, 205
SmiMI CAYNNNNRTG 2 cut(s) 84, 226
Sse9I AATT 4 cut(s) 8, 105, 152, 176
SsiI CCGC 1 cut(s) 244
SspMI CTAG 1 cut(s) 131
StyD4I CCNGG 1 cut(s) 157
TaaI ACNGT 1 cut(s) 274
TasI AATT 4 cut(s) 8, 105, 152, 176
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TseFI GTSAC 1 cut(s) 203
Tsp45I GTSAC 1 cut(s) 203
XapI RAATTY 2 cut(s) 152, 176
XbaI TCTAGA 1 cut(s) 130
XceI RCATGY 1 cut(s) 211
XcmI CCANNNNNNNNNTGG 2 cut(s) 111, 228
XspI CTAG 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.