Rh2CG405000

Protein SAWADEE HOMEODOMAIN HOMOLOG

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
55167897 .. 55170566
2670 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG405000.1

Sequence Viewer

Length: 210 bp
ATGCCAGGCCTGACAGAGGGAGTTCTTCATTGGCTTCACAAAGGGCCAGATGGAGAGAATGGACAAATTGGTGAGGGAGTCCGGAGAAGCAGTACTTGCCAAGAATTTTGTCAAAATTTGGCAAAAAGTTTTAATCACTCTGCTGGTCGTGCTGGAAAACCAATTGTGAAATGGATTCAGGTGCAAAATTGGTTCCAGGAAAGGATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.78

Weight (kDa)

8.8

Isoelectric Point (pI)

31.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 81
AcsI RAATTY 2 cut(s) 104, 115
AfaI GTAC 1 cut(s) 94
AfiI CCNNNNNNNGG 1 cut(s) 16
AjnI CCWGG 2 cut(s) 4, 195
Aor13HI TCCGGA 1 cut(s) 81
AoxI GGCC 2 cut(s) 7, 44
ApoI RAATTY 2 cut(s) 104, 115
AspS9I GGNCC 1 cut(s) 44
AsuHPI GGTGA 1 cut(s) 83
BccI CCATC 1 cut(s) 44
BciT130I CCWGG 2 cut(s) 6, 197
BmcAI AGTACT 1 cut(s) 94
Bme1390I CCNGG 2 cut(s) 6, 197
BmgT120I GGNCC 1 cut(s) 44
BmiI GGNNCC 1 cut(s) 194
BmrFI CCNGG 2 cut(s) 6, 197
BsaWI WCCGGW 1 cut(s) 81
BsaXI ACNNNNNCTCC 2 cut(s) 76, 106
Bsc4I CCNNNNNNNGG 1 cut(s) 16
BseAI TCCGGA 1 cut(s) 81
BseBI CCWGG 2 cut(s) 6, 197
BseGI GGATG 1 cut(s) 210
BseLI CCNNNNNNNGG 1 cut(s) 16
BshFI GGCC 2 cut(s) 9, 46
BsiSI CCGG 1 cut(s) 82
BslI CCNNNNNNNGG 1 cut(s) 16
BsnI GGCC 2 cut(s) 9, 46
Bsp13I TCCGGA 1 cut(s) 81
BspANI GGCC 2 cut(s) 9, 46
BspEI TCCGGA 1 cut(s) 81
BspLI GGNNCC 1 cut(s) 194
Bst2UI CCWGG 2 cut(s) 6, 197
BstAPI GCANNNNNTGC 1 cut(s) 96
BstENI CCTNNNNNAGG 1 cut(s) 14
BstF5I GGATG 1 cut(s) 210
BstMWI GCNNNNNNNGC 2 cut(s) 96, 149
BstNI CCWGG 2 cut(s) 6, 197
BstSCI CCNGG 2 cut(s) 4, 195
BsuRI GGCC 2 cut(s) 9, 46
BtsCI GGATG 1 cut(s) 210
Cfr13I GGNCC 1 cut(s) 44
Csp6I GTAC 1 cut(s) 93
CviJI RGCY 3 cut(s) 9, 34, 46
CviKI_1 RGCY 3 cut(s) 9, 34, 46
CviQI GTAC 1 cut(s) 93
Eco147I AGGCCT 1 cut(s) 9
EcoNI CCTNNNNNAGG 1 cut(s) 14
EcoRII CCWGG 2 cut(s) 4, 195
FalI AAGNNNNNCTT 2 cut(s) 79, 111
HaeIII GGCC 2 cut(s) 9, 46
HapII CCGG 1 cut(s) 82
HinfI GANTC 2 cut(s) 78, 175
HpaII CCGG 1 cut(s) 82
HphI GGTGA 1 cut(s) 83
Hpy188III TCNNGA 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 184
HpyF10VI GCNNNNNNNGC 2 cut(s) 96, 149
Kpn2I TCCGGA 1 cut(s) 81
LpnPI CCDG 8 cut(s) 18, 23, 60, 95, 129, 138, 164, 182
MboII GAAGA 1 cut(s) 17
MfeI CAATTG 1 cut(s) 162
MluCI AATT 5 cut(s) 66, 104, 115, 162, 187
MlyI GAGTC 1 cut(s) 87
MnlI CCTC 2 cut(s) 10, 67
MroI TCCGGA 1 cut(s) 81
MseI TTAA 1 cut(s) 132
MspI CCGG 1 cut(s) 82
MspR9I CCNGG 2 cut(s) 6, 197
MunI CAATTG 1 cut(s) 162
MvaI CCWGG 2 cut(s) 6, 197
MwoI GCNNNNNNNGC 2 cut(s) 96, 149
NlaIV GGNNCC 1 cut(s) 194
PceI AGGCCT 1 cut(s) 9
PfeI GAWTC 1 cut(s) 175
PfoI TCCNGGA 1 cut(s) 195
PleI GAGTC 1 cut(s) 86
PpsI GAGTC 1 cut(s) 86
Psp6I CCWGG 2 cut(s) 4, 195
PspGI CCWGG 2 cut(s) 4, 195
PspN4I GGNNCC 1 cut(s) 194
PspPI GGNCC 1 cut(s) 44
RsaI GTAC 1 cut(s) 94
RsaNI GTAC 1 cut(s) 93
SaqAI TTAA 1 cut(s) 132
Sau96I GGNCC 1 cut(s) 44
ScaI AGTACT 1 cut(s) 94
SchI GAGTC 1 cut(s) 87
ScrFI CCNGG 2 cut(s) 6, 197
SetI ASST 1 cut(s) 183
Sse9I AATT 5 cut(s) 66, 104, 115, 162, 187
SseBI AGGCCT 1 cut(s) 9
StuI AGGCCT 1 cut(s) 9
StyD4I CCNGG 2 cut(s) 4, 195
TasI AATT 5 cut(s) 66, 104, 115, 162, 187
TatI WGTACW 1 cut(s) 92
TfiI GAWTC 1 cut(s) 175
Tru1I TTAA 1 cut(s) 132
Tru9I TTAA 1 cut(s) 132
TspDTI ATGAA 1 cut(s) 17
XagI CCTNNNNNAGG 1 cut(s) 14
XapI RAATTY 2 cut(s) 104, 115
XcmI CCANNNNNNNNNTGG 1 cut(s) 168
ZrmI AGTACT 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.