Rorug05G0291000

Protein SAWADEE HOMEODOMAIN HOMOLOG

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0000905
Physical Location & Seq
Forward (+)
33427503 .. 33428141
639 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0291000.1

Sequence Viewer

Length: 303 bp
ATGTTGCCACAAGGGATTAAGAAAGCCGTGACGGATAATCCAAAGAAACTAGCCAACTTGATTGACCTGGTGAATCTTCCTTCAACACTGAGAGAGTTTGTGGGTCAGTCTCAGATTTCCCGTCTTGGATGTTTCGTGCGTGTCTGGTCGTACATCAAGGACAACAATCTCCAGGATCCAAACAACAAGAATGTGGTCAACTGTGATGAGAAGTTGAAGAGTATTTTGTTGGGCAAGCCTCAAGTTGAGTTAGCTGAGCTTCCTGCATTGATCAAGCTCCATTTCCCCAAAGAGGTTAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SAWADEE

Protein Analysis

100

Amino Acids

11.28

Weight (kDa)

9.39

Isoelectric Point (pI)

34.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SWIB PF02201 24 - 95 8.4e-23 SWIB/MDM2 domain
SWIB_eIF2D PF26291 48 - 86 2.7e-07 eIF2D, SWIB domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 170, 183
AfaI GTAC 1 cut(s) 152
AfiI CCNNNNNNNGG 1 cut(s) 292
AgsI TTSAA 2 cut(s) 84, 217
AjnI CCWGG 2 cut(s) 66, 171
AluBI AGCT 3 cut(s) 254, 259, 277
AluI AGCT 3 cut(s) 254, 259, 277
Alw26I GTCTC 1 cut(s) 114
AlwI GGATC 2 cut(s) 170, 183
AsuHPI GGTGA 1 cut(s) 82
BamHI GGATCC 1 cut(s) 175
BceAI ACGGC 1 cut(s) 11
BciT130I CCWGG 2 cut(s) 68, 173
BclI TGATCA 1 cut(s) 270
BcoDI GTCTC 1 cut(s) 114
BfaI CTAG 1 cut(s) 50
BlpI GCTNAGC 1 cut(s) 255
Bme1390I CCNGG 2 cut(s) 68, 173
BmiI GGNNCC 1 cut(s) 177
BmrFI CCNGG 2 cut(s) 68, 173
BpmI CTGGAG 1 cut(s) 155
Bpu1102I GCTNAGC 1 cut(s) 255
BpuEI CTTGAG 1 cut(s) 225
Bsc4I CCNNNNNNNGG 1 cut(s) 292
BseBI CCWGG 2 cut(s) 68, 173
BseGI GGATG 1 cut(s) 134
BseLI CCNNNNNNNGG 1 cut(s) 292
BseMII CTCAG 3 cut(s) 80, 125, 246
BslI CCNNNNNNNGG 1 cut(s) 292
BsmAI GTCTC 1 cut(s) 114
Bsp143I GATC 2 cut(s) 175, 270
Bsp1720I GCTNAGC 1 cut(s) 255
BspCNI CTCAG 3 cut(s) 81, 124, 247
BspLI GGNNCC 1 cut(s) 177
BspPI GGATC 2 cut(s) 170, 183
BssMI GATC 2 cut(s) 175, 270
Bst2UI CCWGG 2 cut(s) 68, 173
Bst4CI ACNGT 1 cut(s) 203
Bst6I CTCTTC 1 cut(s) 212
BstC8I GCNNGC 1 cut(s) 236
BstDEI CTNAG 3 cut(s) 89, 111, 255
BstF5I GGATG 1 cut(s) 134
BstKTI GATC 2 cut(s) 178, 273
BstMAI GTCTC 1 cut(s) 114
BstMBI GATC 2 cut(s) 175, 270
BstNI CCWGG 2 cut(s) 68, 173
BstSCI CCNGG 2 cut(s) 66, 171
BstX2I RGATCY 1 cut(s) 175
BstYI RGATCY 1 cut(s) 175
BtsCI GGATG 1 cut(s) 134
BtsIMutI CAGTG 1 cut(s) 86
Cac8I GCNNGC 1 cut(s) 236
CsiI ACCWGGT 1 cut(s) 66
Csp6I GTAC 1 cut(s) 151
CviJI RGCY 6 cut(s) 26, 53, 238, 254, 259, 277
CviKI_1 RGCY 6 cut(s) 26, 53, 238, 254, 259, 277
CviQI GTAC 1 cut(s) 151
DdeI CTNAG 3 cut(s) 89, 111, 255
DpnI GATC 2 cut(s) 177, 272
DpnII GATC 2 cut(s) 175, 270
Eam1104I CTCTTC 1 cut(s) 212
EarI CTCTTC 1 cut(s) 212
EcoRII CCWGG 2 cut(s) 66, 171
FbaI TGATCA 1 cut(s) 270
FokI GGATG 1 cut(s) 141
FspBI CTAG 1 cut(s) 50
GsuI CTGGAG 1 cut(s) 155
HincII GTYRAC 1 cut(s) 199
HindII GTYRAC 1 cut(s) 199
HinfI GANTC 1 cut(s) 73
HphI GGTGA 1 cut(s) 82
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 1 cut(s) 114
Hpy8I GTNNAC 1 cut(s) 199
HpyAV CCTTC 1 cut(s) 90
HpyCH4III ACNGT 1 cut(s) 203
HpyCH4V TGCA 1 cut(s) 266
HpyF3I CTNAG 3 cut(s) 89, 111, 255
Ksp22I TGATCA 1 cut(s) 270
Kzo9I GATC 2 cut(s) 175, 270
LmnI GCTCC 1 cut(s) 282
LpnPI CCDG 6 cut(s) 53, 80, 130, 158, 185, 276
MabI ACCWGGT 1 cut(s) 66
MaeI CTAG 1 cut(s) 50
MaeIII GTNAC 1 cut(s) 28
MalI GATC 2 cut(s) 177, 272
MboI GATC 2 cut(s) 175, 270
MboII GAAGA 2 cut(s) 68, 229
MflI RGATCY 1 cut(s) 175
MnlI CCTC 2 cut(s) 249, 286
MseI TTAA 2 cut(s) 18, 297
MspR9I CCNGG 2 cut(s) 68, 173
MvaI CCWGG 2 cut(s) 68, 173
NdeII GATC 2 cut(s) 175, 270
NlaIV GGNNCC 1 cut(s) 177
NmuCI GTSAC 1 cut(s) 28
PfeI GAWTC 1 cut(s) 73
PfoI TCCNGGA 1 cut(s) 171
Psp6I CCWGG 2 cut(s) 66, 171
PspGI CCWGG 2 cut(s) 66, 171
PspN4I GGNNCC 1 cut(s) 177
PsuI RGATCY 1 cut(s) 175
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
SaqAI TTAA 2 cut(s) 18, 297
Sau3AI GATC 2 cut(s) 175, 270
ScrFI CCNGG 2 cut(s) 68, 173
SetI ASST 5 cut(s) 69, 256, 261, 279, 297
SexAI ACCWGGT 1 cut(s) 66
SmlI CTYRAG 1 cut(s) 240
SmoI CTYRAG 1 cut(s) 240
SspMI CTAG 1 cut(s) 50
StyD4I CCNGG 2 cut(s) 66, 171
TaaI ACNGT 1 cut(s) 203
TfiI GAWTC 1 cut(s) 73
Tru1I TTAA 2 cut(s) 18, 297
Tru9I TTAA 2 cut(s) 18, 297
TscAI CASTG 1 cut(s) 93
TseFI GTSAC 1 cut(s) 28
Tsp45I GTSAC 1 cut(s) 28
TspGWI ACGGA 1 cut(s) 47
TspRI CASTG 1 cut(s) 93
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.