Rh4CG272400

Protein SAWADEE HOMEODOMAIN HOMOLOG

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0000905
Physical Location & Seq
Reverse (-)
52662964 .. 52663575
612 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG272400.1

Sequence Viewer

Length: 177 bp
ATGGACCATGGCCTTAGTCCCAAACAGAGGGAGTTCTTCATTGGCTTCACAAAGGGCGAGATGGAGAGAATGGACAAATTGGTGATGGAGTCAAGAGACGCAGTGCTTGCCAAAGAATTTTGTCAAAATTTGGCAAAAAGTTTTAATCACTCCGCTGGTCGTGCTGGAAAACCAATT
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SAWADEE

Protein Analysis

59

Amino Acids

6.69

Weight (kDa)

8.98

Isoelectric Point (pI)

16.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 153
AcsI RAATTY 2 cut(s) 116, 127
AfiI CCNNNNNNNGG 1 cut(s) 27
Alw26I GTCTC 1 cut(s) 90
AoxI GGCC 1 cut(s) 10
ApoI RAATTY 2 cut(s) 116, 127
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 94
AvaII GGWCC 1 cut(s) 4
BccI CCATC 2 cut(s) 55, 79
BcoDI GTCTC 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BsaJI CCNNGG 1 cut(s) 7
Bsc4I CCNNNNNNNGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 7
BseLI CCNNNNNNNGG 1 cut(s) 27
BshFI GGCC 1 cut(s) 12
BslFI GGGAC 1 cut(s) 3
BslI CCNNNNNNNGG 1 cut(s) 27
BsmAI GTCTC 1 cut(s) 90
BsmBI CGTCTC 1 cut(s) 90
BsmFI GGGAC 1 cut(s) 3
BsnI GGCC 1 cut(s) 12
Bsp19I CCATGG 1 cut(s) 7
BspACI CCGC 1 cut(s) 153
BspANI GGCC 1 cut(s) 12
BssECI CCNNGG 1 cut(s) 7
BssT1I CCWWGG 1 cut(s) 7
BstAPI GCANNNNNTGC 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 14
BstDSI CCRYGG 1 cut(s) 7
BstMAI GTCTC 1 cut(s) 90
BstMWI GCNNNNNNNGC 2 cut(s) 107, 161
BsuRI GGCC 1 cut(s) 12
BtgI CCRYGG 1 cut(s) 7
BtsI GCAGTG 1 cut(s) 108
BtsIMutI CAGTG 1 cut(s) 108
Cac8I GCNNGC 1 cut(s) 108
Cfr13I GGNCC 1 cut(s) 4
CseI GACGC 1 cut(s) 107
CviAII CATG 1 cut(s) 8
CviJI RGCY 2 cut(s) 12, 45
CviKI_1 RGCY 2 cut(s) 12, 45
DdeI CTNAG 1 cut(s) 14
Eco130I CCWWGG 1 cut(s) 7
Eco47I GGWCC 1 cut(s) 4
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
Esp3I CGTCTC 1 cut(s) 90
FaeI CATG 1 cut(s) 11
FaiI YATR 1 cut(s) 9
FaqI GGGAC 1 cut(s) 3
FatI CATG 1 cut(s) 7
HaeIII GGCC 1 cut(s) 12
HgaI GACGC 1 cut(s) 107
Hin1II CATG 1 cut(s) 11
HinfI GANTC 1 cut(s) 89
HphI GGTGA 1 cut(s) 94
Hpy188III TCNNGA 1 cut(s) 93
HpyF10VI GCNNNNNNNGC 2 cut(s) 107, 161
HpyF3I CTNAG 1 cut(s) 14
Hsp92II CATG 1 cut(s) 11
LpnPI CCDG 2 cut(s) 141, 150
MboII GAAGA 1 cut(s) 28
MluCI AATT 3 cut(s) 77, 116, 127
MlyI GAGTC 1 cut(s) 98
MnlI CCTC 1 cut(s) 21
MseI TTAA 1 cut(s) 144
MspA1I CMGCKG 1 cut(s) 155
MwoI GCNNNNNNNGC 2 cut(s) 107, 161
NcoI CCATGG 1 cut(s) 7
NlaIII CATG 1 cut(s) 11
PleI GAGTC 1 cut(s) 97
PpsI GAGTC 1 cut(s) 97
PspPI GGNCC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 144
Sau96I GGNCC 1 cut(s) 4
SchI GAGTC 1 cut(s) 98
SgeI CNNG 6 cut(s) 20, 70, 105, 119, 168, 173
SinI GGWCC 1 cut(s) 4
Sse9I AATT 3 cut(s) 77, 116, 127
SsiI CCGC 1 cut(s) 153
StyI CCWWGG 1 cut(s) 7
TasI AATT 3 cut(s) 77, 116, 127
Tru1I TTAA 1 cut(s) 144
Tru9I TTAA 1 cut(s) 144
TscAI CASTG 1 cut(s) 108
TspDTI ATGAA 1 cut(s) 28
TspRI CASTG 1 cut(s) 108
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 2 cut(s) 116, 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.