RchiOBHm_Chr4g0406561

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
28370510 .. 28370746
237 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 174 bp
ATGCTAGTCAATGGGGTTTCTCCTGATGGTGTAACCTTCCTTGGGTTATTAACAGCATGCAGTCATGCAGGCCTTGTAAACCAAGGGTTGATGTTCTTCAAGGCTATGAAGAAAGTTTACTGGATTGTCCCTGAAACACAATATCATGCTTGTTTGGTCGATATGTACGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.27

Weight (kDa)

6.69

Isoelectric Point (pI)

28.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 167
AfiI CCNNNNNNNGG 1 cut(s) 42
AgsI TTSAA 1 cut(s) 100
AoxI GGCC 1 cut(s) 70
BarI GAAGNNNNNNTAC 2 cut(s) 101, 133
BccI CCATC 1 cut(s) 20
BfaI CTAG 1 cut(s) 5
BsaJI CCNNGG 2 cut(s) 40, 82
Bsc4I CCNNNNNNNGG 1 cut(s) 42
Bse1I ACTGG 1 cut(s) 125
BseDI CCNNGG 2 cut(s) 40, 82
BseLI CCNNNNNNNGG 1 cut(s) 42
BseNI ACTGG 1 cut(s) 125
BshFI GGCC 1 cut(s) 72
BslFI GGGAC 1 cut(s) 113
BslI CCNNNNNNNGG 1 cut(s) 42
BsmFI GGGAC 1 cut(s) 113
BsnI GGCC 1 cut(s) 72
BspANI GGCC 1 cut(s) 72
BsrI ACTGG 1 cut(s) 125
BssECI CCNNGG 2 cut(s) 40, 82
BssT1I CCWWGG 2 cut(s) 40, 82
Bst4CI ACNGT 1 cut(s) 170
BstC8I GCNNGC 2 cut(s) 58, 70
BstNSI RCATGY 1 cut(s) 60
BsuRI GGCC 1 cut(s) 72
Cac8I GCNNGC 2 cut(s) 58, 70
Csp6I GTAC 1 cut(s) 166
CviAII CATG 3 cut(s) 57, 65, 146
CviJI RGCY 2 cut(s) 72, 104
CviKI_1 RGCY 2 cut(s) 72, 104
CviQI GTAC 1 cut(s) 166
Eco130I CCWWGG 2 cut(s) 40, 82
Eco147I AGGCCT 1 cut(s) 72
EcoT14I CCWWGG 2 cut(s) 40, 82
ErhI CCWWGG 2 cut(s) 40, 82
FaeI CATG 3 cut(s) 60, 68, 149
FaiI YATR 5 cut(s) 58, 66, 107, 147, 164
FaqI GGGAC 1 cut(s) 113
FatI CATG 3 cut(s) 56, 64, 145
FspBI CTAG 1 cut(s) 5
HaeIII GGCC 1 cut(s) 72
Hin1II CATG 3 cut(s) 60, 68, 149
Hpy166II GTNNAC 2 cut(s) 79, 118
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 2 cut(s) 79, 118
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 1 cut(s) 170
HpyCH4V TGCA 2 cut(s) 60, 68
Hsp92II CATG 3 cut(s) 60, 68, 149
LpnPI CCDG 4 cut(s) 36, 54, 106, 144
MaeI CTAG 1 cut(s) 5
MaeIII GTNAC 1 cut(s) 31
MboII GAAGA 2 cut(s) 88, 121
MseI TTAA 1 cut(s) 50
NlaIII CATG 3 cut(s) 60, 68, 149
NspI RCATGY 1 cut(s) 60
PaeI GCATGC 1 cut(s) 60
PceI AGGCCT 1 cut(s) 72
RsaI GTAC 1 cut(s) 167
RsaNI GTAC 1 cut(s) 166
SaqAI TTAA 1 cut(s) 50
SetI ASST 1 cut(s) 38
SphI GCATGC 1 cut(s) 60
SseBI AGGCCT 1 cut(s) 72
SspMI CTAG 1 cut(s) 5
StuI AGGCCT 1 cut(s) 72
StyI CCWWGG 2 cut(s) 40, 82
TaaI ACNGT 1 cut(s) 170
TaqI TCGA 1 cut(s) 159
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
TspDTI ATGAA 1 cut(s) 122
XceI RCATGY 1 cut(s) 60
XspI CTAG 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.