RchiOBHm_Chr2g0154961

Rop guanine nucleotide exchange factor

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
71977415 .. 71977999
585 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 141 bp
ATGACTCCGAAAGCTCGTGCAGACATACACATCAATCTTCCAGCACTTAAGAAGTTGGACTCGATGCTTATTGAAACACTTGATTCAATGGTGGATACTGAGTTTGGGTATGTAGAAGGTGGTAGTAGGGCAGAAGGATGA

Protein Analysis

46

Amino Acids

5.02

Weight (kDa)

4.75

Isoelectric Point (pI)

44.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PRONE PF03759 1 - 44 3.3e-17 PRONE (Plant-specific Rop nucleotide exchanger)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflII CTTAAG 1 cut(s) 47
AgsI TTSAA 2 cut(s) 74, 87
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
BauI CACGAG 1 cut(s) 15
BciVI GTATCC 1 cut(s) 88
BfrI CTTAAG 1 cut(s) 47
BfuI GTATCC 1 cut(s) 88
BmsI GCATC 1 cut(s) 54
BseMII CTCAG 1 cut(s) 90
BsgI GTGCAG 1 cut(s) 39
BspCNI CTCAG 1 cut(s) 91
BspTI CTTAAG 1 cut(s) 47
BssSI CACGAG 1 cut(s) 15
Bst2BI CACGAG 1 cut(s) 15
BstAFI CTTAAG 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 99
BsuI GTATCC 1 cut(s) 88
CviJI RGCY 1 cut(s) 14
CviKI_1 RGCY 1 cut(s) 14
DdeI CTNAG 1 cut(s) 99
FaiI YATR 2 cut(s) 26, 111
HinfI GANTC 3 cut(s) 4, 59, 83
Hpy188I TCNGA 1 cut(s) 9
HpyAV CCTTC 2 cut(s) 110, 128
HpyCH4V TGCA 1 cut(s) 20
HpyF3I CTNAG 1 cut(s) 99
LpnPI CCDG 1 cut(s) 54
LweI GCATC 1 cut(s) 54
MboII GAAGA 1 cut(s) 29
MlyI GAGTC 1 cut(s) 53
MmeI TCCRAC 1 cut(s) 36
MseI TTAA 1 cut(s) 48
MspCI CTTAAG 1 cut(s) 47
PfeI GAWTC 1 cut(s) 83
PleI GAGTC 1 cut(s) 53
PpsI GAGTC 1 cut(s) 53
SaqAI TTAA 1 cut(s) 48
SchI GAGTC 1 cut(s) 53
SetI ASST 2 cut(s) 16, 121
SfaNI GCATC 1 cut(s) 54
SgeI CNNG 5 cut(s) 27, 29, 53, 73, 92
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
TaqI TCGA 1 cut(s) 62
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
Vha464I CTTAAG 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.