RchiOBHm_Chr4g0400631

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0000939
Physical Location & Seq
Forward (+)
18337734 .. 18339759
2026 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37262

Sequence Viewer

Length: 282 bp
ATGGGCTTGAACATTGATCCCAAGCTCAGATTGGACAGTGAGAAGACATTAAAGGATGGTGACTCATTGATGAACGTCGGAAAGCTGAAGGAAGCATTACCCTACTATGAGAAAGTTATGGATAAGTTACCATTCAAGATTATGACTCCGAAAGCTCATGCAGACATACACATCAATCTTCCAGCACTTAAGAAGTTGGACTCGATGCTTATTGTAGGTGGCCTCTTATATGCCAGCAATGTTAATAGCACTTTTTCCTTTTCTTTTCCTGGCTTACATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

10.35

Weight (kDa)

8.89

Isoelectric Point (pI)

32.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PRONE PF03759 28 - 71 8e-09 PRONE (Plant-specific Rop nucleotide exchanger)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 11
AcuI CTGAAG 1 cut(s) 107
AflII CTTAAG 1 cut(s) 188
AgsI TTSAA 2 cut(s) 10, 136
AjnI CCWGG 1 cut(s) 268
AluBI AGCT 3 cut(s) 25, 85, 155
AluI AGCT 3 cut(s) 25, 85, 155
AlwI GGATC 1 cut(s) 11
AoxI GGCC 1 cut(s) 220
AsuHPI GGTGA 1 cut(s) 71
BbsI GAAGAC 1 cut(s) 50
BccI CCATC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 270
BfrI CTTAAG 1 cut(s) 188
Bme1390I CCNGG 1 cut(s) 270
BmrFI CCNGG 1 cut(s) 270
BmsI GCATC 1 cut(s) 195
BpiI GAAGAC 1 cut(s) 50
Bse3DI GCAATG 1 cut(s) 244
BseBI CCWGG 1 cut(s) 270
BseGI GGATG 1 cut(s) 61
BseMI GCAATG 1 cut(s) 244
BseMII CTCAG 1 cut(s) 40
BshFI GGCC 1 cut(s) 222
BsnI GGCC 1 cut(s) 222
Bsp143I GATC 1 cut(s) 16
BspANI GGCC 1 cut(s) 222
BspCNI CTCAG 1 cut(s) 39
BspPI GGATC 1 cut(s) 11
BspTI CTTAAG 1 cut(s) 188
BsrDI GCAATG 1 cut(s) 244
BssMI GATC 1 cut(s) 16
Bst2UI CCWGG 1 cut(s) 270
Bst4CI ACNGT 1 cut(s) 38
BstAFI CTTAAG 1 cut(s) 188
BstC8I GCNNGC 1 cut(s) 235
BstDEI CTNAG 1 cut(s) 26
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 1 cut(s) 19
BstMBI GATC 1 cut(s) 16
BstNI CCWGG 1 cut(s) 270
BstSCI CCNGG 1 cut(s) 268
BstV2I GAAGAC 1 cut(s) 50
BsuRI GGCC 1 cut(s) 222
BtsCI GGATG 1 cut(s) 61
BtsIMutI CAGTG 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 235
CviAII CATG 1 cut(s) 158
CviJI RGCY 6 cut(s) 6, 25, 85, 155, 222, 273
CviKI_1 RGCY 6 cut(s) 6, 25, 85, 155, 222, 273
DdeI CTNAG 1 cut(s) 26
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
Eco57I CTGAAG 1 cut(s) 107
EcoRII CCWGG 1 cut(s) 268
FaeI CATG 1 cut(s) 161
FaiI YATR 7 cut(s) 108, 119, 143, 159, 167, 229, 231
FatI CATG 1 cut(s) 157
FokI GGATG 1 cut(s) 68
HaeIII GGCC 1 cut(s) 222
Hin1II CATG 1 cut(s) 161
HinfI GANTC 3 cut(s) 62, 145, 200
HphI GGTGA 1 cut(s) 71
Hpy188I TCNGA 3 cut(s) 29, 80, 150
Hpy188III TCNNGA 1 cut(s) 136
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 82
HpyCH4III ACNGT 1 cut(s) 38
HpyCH4IV ACGT 1 cut(s) 75
HpyCH4V TGCA 1 cut(s) 161
HpyF3I CTNAG 1 cut(s) 26
HpySE526I ACGT 1 cut(s) 75
Hsp92II CATG 1 cut(s) 161
Kzo9I GATC 1 cut(s) 16
LpnPI CCDG 3 cut(s) 195, 247, 255
LweI GCATC 1 cut(s) 195
MaeII ACGT 1 cut(s) 75
MaeIII GTNAC 2 cut(s) 59, 126
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MboII GAAGA 2 cut(s) 55, 170
MlyI GAGTC 3 cut(s) 56, 139, 194
MmeI TCCRAC 2 cut(s) 58, 177
MnlI CCTC 1 cut(s) 233
MseI TTAA 4 cut(s) 50, 189, 243, 280
MspCI CTTAAG 1 cut(s) 188
MspR9I CCNGG 1 cut(s) 270
MvaI CCWGG 1 cut(s) 270
NdeII GATC 1 cut(s) 16
NlaIII CATG 1 cut(s) 161
NmuCI GTSAC 1 cut(s) 59
PleI GAGTC 3 cut(s) 56, 139, 194
PpsI GAGTC 3 cut(s) 56, 139, 194
Psp6I CCWGG 1 cut(s) 268
PspGI CCWGG 1 cut(s) 268
SaqAI TTAA 4 cut(s) 50, 189, 243, 280
Sau3AI GATC 1 cut(s) 16
SchI GAGTC 3 cut(s) 56, 139, 194
ScrFI CCNGG 1 cut(s) 270
SetI ASST 5 cut(s) 27, 78, 87, 157, 220
SfaNI GCATC 1 cut(s) 195
SgeI CNNG 7 cut(s) 19, 34, 148, 170, 194, 214, 246
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
StyD4I CCNGG 1 cut(s) 268
TaaI ACNGT 1 cut(s) 38
TaiI ACGT 1 cut(s) 78
TaqI TCGA 1 cut(s) 203
Tru1I TTAA 4 cut(s) 50, 189, 243, 280
Tru9I TTAA 4 cut(s) 50, 189, 243, 280
TscAI CASTG 1 cut(s) 43
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
TspDTI ATGAA 1 cut(s) 86
TspRI CASTG 1 cut(s) 43
Vha464I CTTAAG 1 cut(s) 188
XcmI CCANNNNNNNNNTGG 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.