Rh5AG377400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
64509625 .. 64510013
389 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG377400.1

Sequence Viewer

Length: 282 bp
ATGTCCCTAGTCGACTTGCCAAGTCCTGGGAATGCCGAATTGCCTGTTGTTGTTAAGACTGCAATGGAGAGAGCTAGAGAGTATAAGCAGAAGAAGAAAGGGACTAACAAAACTTCAGGTGTTGAAGCAAATGAGAAAAACAAGGGAAAATTGTCAGTGTCGAGCATGGATTTTGTGGGACTTGGGTTTGCCAATAAGAAGGAGGGTAGAGCACTACCCACTGGGTTGGTTCCAATCGCAGACGATTTTGCTCAGGGAAACTTGCCTGAGGTTGAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

93

Amino Acids

9.94

Weight (kDa)

8.96

Isoelectric Point (pI)

35.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 26
AccI GTMKAC 1 cut(s) 12
AcuI CTGAAG 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 26
AgsI TTSAA 1 cut(s) 125
AjnI CCWGG 1 cut(s) 25
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
Alw21I GWGCWC 1 cut(s) 214
AxyI CCTNAGG 1 cut(s) 267
Bbv12I GWGCWC 1 cut(s) 214
BciT130I CCWGG 1 cut(s) 27
BfaI CTAG 2 cut(s) 8, 75
Bme1390I CCNGG 1 cut(s) 27
BmiI GGNNCC 1 cut(s) 231
BmrFI CCNGG 1 cut(s) 27
BmrI ACTGGG 1 cut(s) 231
BmuI ACTGGG 1 cut(s) 231
Bpu10I CCTNAGC 1 cut(s) 252
BsaJI CCNNGG 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 226
Bse21I CCTNAGG 1 cut(s) 267
Bse3DI GCAATG 1 cut(s) 69
BseBI CCWGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 26
BseLI CCNNNNNNNGG 1 cut(s) 26
BseMI GCAATG 1 cut(s) 69
BseMII CTCAG 2 cut(s) 258, 266
BseNI ACTGG 1 cut(s) 226
BsiHKAI GWGCWC 1 cut(s) 214
BslFI GGGAC 2 cut(s) 115, 192
BslI CCNNNNNNNGG 1 cut(s) 26
BsmFI GGGAC 2 cut(s) 115, 192
BsmI GAATGC 1 cut(s) 37
Bsp1286I GDGCHC 1 cut(s) 214
BspCNI CTCAG 2 cut(s) 259, 265
BspLI GGNNCC 1 cut(s) 231
BsrDI GCAATG 1 cut(s) 69
BsrI ACTGG 1 cut(s) 226
BssECI CCNNGG 1 cut(s) 26
Bst2UI CCWGG 1 cut(s) 27
BstDEI CTNAG 2 cut(s) 252, 267
BstNI CCWGG 1 cut(s) 27
BstSCI CCNGG 1 cut(s) 25
BstXI CCANNNNNNTGG 1 cut(s) 226
Bsu36I CCTNAGG 1 cut(s) 267
BtsIMutI CAGTG 2 cut(s) 162, 219
CviAII CATG 1 cut(s) 166
CviJI RGCY 1 cut(s) 74
CviKI_1 RGCY 1 cut(s) 74
DdeI CTNAG 2 cut(s) 252, 267
Eco57I CTGAAG 1 cut(s) 99
Eco81I CCTNAGG 1 cut(s) 267
EcoRII CCWGG 1 cut(s) 25
FaeI CATG 1 cut(s) 169
FaiI YATR 2 cut(s) 84, 167
FaqI GGGAC 2 cut(s) 115, 192
FatI CATG 1 cut(s) 165
FblI GTMKAC 1 cut(s) 12
FspBI CTAG 2 cut(s) 8, 75
Hin1II CATG 1 cut(s) 169
HincII GTYRAC 1 cut(s) 13
HindII GTYRAC 1 cut(s) 13
Hpy166II GTNNAC 1 cut(s) 13
Hpy8I GTNNAC 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 193
HpyCH4V TGCA 1 cut(s) 62
HpyF3I CTNAG 2 cut(s) 252, 267
Hsp92II CATG 1 cut(s) 169
LpnPI CCDG 6 cut(s) 12, 39, 57, 102, 207, 239
MaeI CTAG 2 cut(s) 8, 75
MboII GAAGA 2 cut(s) 103, 106
MhlI GDGCHC 1 cut(s) 214
MluCI AATT 2 cut(s) 38, 149
MnlI CCTC 2 cut(s) 196, 262
MseI TTAA 1 cut(s) 54
MspR9I CCNGG 1 cut(s) 27
Mva1269I GAATGC 1 cut(s) 37
MvaI CCWGG 1 cut(s) 27
NlaIII CATG 1 cut(s) 169
NlaIV GGNNCC 1 cut(s) 231
PctI GAATGC 1 cut(s) 37
PflMI CCANNNNNTGG 1 cut(s) 26
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 231
SalI GTCGAC 1 cut(s) 11
SaqAI TTAA 1 cut(s) 54
ScrFI CCNGG 1 cut(s) 27
SduI GDGCHC 1 cut(s) 214
SetI ASST 3 cut(s) 76, 121, 273
Sse9I AATT 2 cut(s) 38, 149
SspMI CTAG 2 cut(s) 8, 75
StyD4I CCNGG 1 cut(s) 25
TaqI TCGA 2 cut(s) 12, 161
TasI AATT 2 cut(s) 38, 149
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TscAI CASTG 2 cut(s) 162, 226
TspRI CASTG 2 cut(s) 162, 226
Van91I CCANNNNNTGG 1 cut(s) 26
XmiI GTMKAC 1 cut(s) 12
XspI CTAG 2 cut(s) 8, 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.